Table 1 in Molecular Characterization of Two Myxosporean Species, Henneguya namae Haldar et al. 1983 and Myxobolus sophorae Jayasri, 1982 (Myxosporea: Myxobolidae)

Table 1. Primers used for PCR and sequencing in the present study.
PrimerSequence (5’–3’)ApplicationSourceERIB1ACCTGGTTGATCCTGCCAG1st round PCRBarta et al. 1997ERIB10CTTCCGCAGGTTCACCTACGG1st round PCRBarta et al. 1997Myx1FGTGAGACTGCGGACGGCTCAG2nd round PCR and sequencingHallet and Diamant 2001SphRGTTACCATTGTAGCGCGCGT2nd round PCR and sequencingEszterbauer and Székely 2004MC5CCTGAGAAACGGCTACCACATCCASequencingMolnár et al. 2002MC3GATTAGCCTGACAGATCACTCCACGASequencingMolnár et al. 2002ACT1rAATTTCACCTCTCGCTGCCASequencingHallet and Diamant 2001