TABLE 1 in A new species of planthopper in the genus Colpoptera (Hemiptera: Fulgoroidea: Nogodinidae) from the Northeastern coast of Jamaica

TABLE 1. Primers used to amplify corresponding gene regions that were used to assess the placement of novel taxon and PCR parameters for each locus. LocusPrimerDirectionSequence (5’ → 3’)AnnealingExtensionReferenceCOICOI_D1_FForwardGGAACWATAAGAAGWATAATYATYCG40 ˚C1 min. 30 sec.Humphries et al. 2021C1-J-2195RCReverseACTTCTGGATGACCAAAAAATCAA18S18SFForwardACTGTCGATGGTAGGTTCTG50 ˚C2 min.Bahder et al. 201918SRReverseGTCCGAAGACCTCACTAAA