Soil metagenome
收藏资源简介:
The study used Chinese cabbage seeds (Brassica rapa L. c. v. Jingcui 60) sourced from Jingyan Yinong Seed Sci-Tech Co., Ltd., Beijing. The soil contains 3.5 percent organic matter, pH of 6.87, 65 percent sand, 18 percent silt, and 17 percent clay, and water holding capacity of 38 percent. The experiment included both planted and non-planted systems. The planted systems were subjected to different treatments: a control treatment (CK, deionized water), Cys100/d (12 micrograms per gram soil, applied ten times), Cys1000 (120 micrograms per gram soil), Thr100/d (12 micrograms per gram soil, applied ten times), and Thr1000 (120 micrograms per gram soil). In the planted system, samples from the treatments CK, Cys 100/d, Cys1000, Thr100/d, and Thr1000 were analyzed for microbial community composition. Bacterial 16S rRNA genes in the V3-V4 region were amplified using specific primers 338 F (ACTCCTACGGGAGGCAGCAG) and 806 R (GGACTACHVGGGTWTCTAAT) following DNA purification and dilution. For fungi, the first internal transcribed spacer (ITS1) region was amplified with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC). In microcosm experiment II, 30 grams of soil was added to a 50 mL centrifuge tube, sealed with a breathable membrane, and subjected to four treatments for 10 days: CK (sterile DI water), Cys 100/d (12 micrograms per gram soil, applied ten times), Cys100 (120 micrograms per gram soil), and Cys1000 (120 micrograms per gram soil) in both nonsterile (N) and sterile (S) soils. Indicators were measured after drying three replicates of each treatment. Microbial changes under different Cys treatments were assessed using 16S rRNA sequencing to determine shifts in the bacterial community composition in nonsterile soil.



