Table 2 in All-inclusive descriptions of new freshwater snail taxa of the hyperdiverse family Tateidae (Gastropoda, Caenogastropoda) from the South Island of New Zealand

Table 2. Diagnostic alignment positions. All characters are of type 1, i.e., they are fixed in a particular taxon. Positions refer to the alignments of COI and 16S rRNA in Electronic Supplements 1 and 2, respectively. Position 382 in bold is the only diagnostic position for Opacuincola gretathunbergae across all samples of the genus. Therefore, it was also compared to its sister species Op. ngatapuna. In Ob. farri, sequencing of COI failed.
SpeciesGenePosition/StatesCOI0 1 30 4 30 4 90 5 80 7 30 7 60 7 90 8 20 9 41 0 31 6 31 6 91 7 51 8 42 0 22 0 82 1 42 2 62 3 22 3 82 4 42 5 02 6 2C. jamiCCTCGATGGGTGGACCCGCGTGAC. matapangoTTCTAGAAAACAAGTTTTTACAGCOI2 6 53 0 73 2 23 3 43 3 73 4 13 5 53 7 04 0 64 3 04 6 04 7 25 1 75 4 75 8 96 1 06 1 66 1 96 2 26 2 56 2 86 4 0C. jamiACGCCTCCAAGCTCTCTACGCTC. matapangoGTATTCTTGGATCTCTCGGTTC16S1 1 91 5 22 2 52 2 62 2 92 3 92 4 32 4 82 4 92 9 13 0 93 1 13 1 24 4 9C. jamiGCATA-AACCCTCTC. matapangoATGCTAGGTTTCTGCOI0 8 91 1 21 9 02 6 52 8 62 8 93 0 74 1 54 6 95 0 25 8 95 9 86 0 76 2 8Op. lisanneaCCGCGGCTCGCCCC16S1 6 53 0 73 1 33 1 93 2 03 2 6Op. lisanneaGG-GCACOI0 0 70 3 70 7 30 8 22 0 22 8 93 8 26 2 2Op. gretathun-CAGAATGGbergaeOp. ngatapunaTGAGGCAA16S133502699Op. gretathun-GCGbergaeOp. ngatapunaATA16S1 0 71 7 62 1 52 4 93 2 1Ob. farriCGTAAOb. alpinusTACGG