Table 1 in Description of Cystodiscus elachistocleis sp. nov. (Cnidaria: Myxosporea) parasitizing the gallbladder of Elachistocleis cesarii from Brazil, based on morphological and molecular analyses

Table 1. Primers used for the amplification and sequencing of the SSU rDNA of Cystodiscus elachistocleis sp. nov. found parasitizing the gallbladder of Elachistocleis cesarii (Miranda-Ribeiro, 1920) from Araguaiana, Mato Grosso State, Brazil.
PrimerSequence 5’-3’Paired withReferenceErib1ACCTGGTTGATCCTAct1rBarta et al. (1997)Act1rAATTTCACCTCTCGCTGCCAErib1Hallett & Diamant (2001)Myxgen4FGTGCCTTGAATAAATCAGAGErib10Diamant et al. (2004)Erib10CTTCCGCAGGTTCACCTACGGMyxgen4FBarta et al. (1997)MX5CTGCGGACGGCTCAGTAAATCAGTMX3Andree et al. (1999)MX3CCAGGACATCTTAGGGCATCACAGAMX5Andree et al. (1999)