TABLE 2 in Descriptions of larvae of four mainly DNA barcode-matched species of chlorocyphids from south-east Asia (Odonata: Chlorocyphidae) with notes on the generic and species level larval identification of Oriental region members of the family.

TABLE 2. Primer combinations used for amplification of COI. Primer nameTargetDirectionSequence (5’ to 3’)ReferenceODO_LCO1490dCOIFTTTCTACWAACCAYAAAGATATTGGDijkstra et al. 2014ODO_HCO2198dCOIRTAAACTTCWGGRTGTCCAAARAATCADijkstra et al. 2014LepF1COIFATTCAACCAATCATAAAGATATTGGHebert et al. 2004LepR1COIRTAAACTTCTGGATGTCCAAAAAATCAHebert et al. 2004LCO1490COIFGGTCAACAAATCATAAAGATATTGGFolmer et al. 1994HCO2198COIRTAAACTTCAGGGTGACCAAAAAATCAFolmer et al. 1994