rCRUX Generated Ford Fish 16S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: Ford Fish 16S<br> Gene: 16S<br> Length of Target: 330<br> get_seeds_local() minimum length: 279<br> get_seeds_local() maximum length: 477<br> blast_seeds() minimum length: 231<br> blast_seeds() maximum length: 429<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC<br> Reverse Sequence (5'-3'): GGATTGCGCTGTTATCCCTA<br> Reference: Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population’s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956 We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.