相关数据集
Amplicons of the mitochondrial barcode from the gaster content of Dorymyrmex brunneus collected off crop season in tillage. Dorymyrmex brunneus
Amplicons of the mitochondrial barcode Ins16S of the gaster content of 100 specimens of Dorymyrmex brunneus collected off crop season in tillage in Brazil in 2015.
NIAID Data Ecosystem60
Genetic diversity in the Diplosoma listerianum complex (Ascidiacea: Didemnidae) from the Western Atlantic
(Received 19 January 2021; revised 27 September 2021; accepted 27 September 2021) Diplosoma listerianum has been re-described with more than 40 currently invalid names, but recent data suggests that s
Figshare2021-11-08 更新60
Supporting Data: Phylogeny of Arbacia Gray, 1835 (Echinoidea) reveals diversification patterns in the Atlantic and Pacific Oceans.
This dataset contains: Appendix S1, metadata asociated with the specimens (collection localities, specimen numbers) The aligned sequence files for each marker: COI_fasta, 16S_fasta, CR_fasta The
NIAID Data Ecosystem00
Amplicons of the mitochondrial barcode from the gut content of males Harmonia axyridis in starvation.. Harmonia axyridis
Raw reads of the amplicons of the mitochondrial barcode Ins16S from the gut content of 5 males Harmonia axyridis in starvation.
NIAID Data Ecosystem60
Table 3 in New record of Nausithoe werneri (Scyphozoa, Coronatae, Nausithoidae) from the Brazilian coast and a new synonymy for Nausithoe maculata
Table 3. List of primers used to amplify each gene. *LEM = Laboratório de Evolução Molecular (IB-USP). GenePrimerPrimer sequence 5'-3'F/RTemp. - base pairsSourceCOICOXl-F2TCGACTAATCATAAAGATATCGGCACF52
NIAID Data Ecosystem10
