Table 1 in Integrative taxonomy supports two new species of Macrobiotus (Tardigrada: Eutardigrada: Macrobiotidae) allowing further discussion on the genus phylogeny

Table 1. Primers with their original references used for amplification of the four DNA fragments sequenced in the study. DNA markerPrimer namePrimer directionPrimer sequence (5’-3’)Primer source18S rRNA18S_Tar_Ff1 18S_Tar_Rr1forward reverseAGGCGAAACCGCGAATGGCTC GCCGCAGGCTCCACTCCTGGStec et al. (2017a)28S rRNA28SF0002 28SR0990forward reverseGRCRAGAKTACCCGCTGAAC CCTTGGTCCGTGTTTCAAGACMironov et al. (2012); Stec (2022a)ITS-2ITS2_Eutar_Ff ITS2_Eutar_Rrforward reverseCGTAACGTGAATTGCAGGAC TCCTCCGCTTATTGATATGCStec et al. (2018a)COILCO1490-JJ HCO2198-JJforward reverseCHACWAAYCATAAAGATATYGG AWACTTCVGGRTGVCCAAARAATCAAstrin & Stüben (2008)