Pigmentation loss after injection of Cas9 or Cpf1 RNPs into zebrafish embryos.
收藏资源简介:
Left side, diagram of experiment. 1-cell zebrafish embryos were injected with 1 nL of either Cas9 or Cpf1 injection mix targeting the tyrosinase gene (tyr). Cas9 injection mix was 10 uM SpCas9 protein (NEB), 150 pg sgRNAs (n=3, made using NEB EnGen sgRNA kit), 50 mM KCl, 2.5 mM MgCl2, 5 mM Tris pH 8, 0.01% phenol red. Cpf1 injection mix was 10 uM LbCpf1 protein (NEB), 150 pg crRNAs (n=3, from Synthego), 50 mM KCl, 2.5 mM MgCl2, 5 mM Tris pH 8, 0.01% phenol red. Injected embryos were grown at 28C. Survival rate was scored at 24 hours-post-fertilization (hpf); both injections had >85% survival. Larvae were anesthetized at 72 hpf and scored for pigmentation. Right side, images of representative uninjected, Cas9 injected and Cpf1 injected larvae, with phenotype scoring indicated in the lower right. Sequences of the sgRNAs and crRNAs used:tyr_Cas9_sgRNA6 GGUGCGCCGGAAACUACAUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUtyr_Cas9_sgRNA9 GGUGUUGGCGAACAUUGGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUtyr_Cas9_sgRNA10 GGGUGUACGAUUUAUUCGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUtyr_Cpf1_crRNA1 UAAUUUCUACUAAGUGUAGAUCAACCAAACCUGCCAGUGCGCCGtyr_Cpf1_crRNA2 UAAUUUCUACUAAGUGUAGAUUUCGUGUGGAUGCAUUAUUACGUtyr_Cpf1_crRNA3 UAAUUUCUACUAAGUGUAGAUCGCAUGAGUCGGCGGCGUUUCUG This experiment reproduces Figure 1f/g of this preprint:https://www.biorxiv.org/content/early/2017/06/26/156125



