454-sequence data of Iron Age cattle from Althiburos – Tunisia

The Maghreb is a key region for understanding the dynamics of cattle dispersal and admixture with local aurochs following their earliest domestication in the Fertile Crescent more than 10,000 years ago. Here, we present data on mitochondrial D-loop sequences obtained for 12 archaeological specimens of Iron Age (~2,800 cal BP–2,000 cal BP) domestic cattle from the Eastern Maghreb, i.e. Althiburos (El Kef, Tunisia). Maternal lineages were assigned to the elusive R and ubiquitous African-T1 haplogroups found in two and ten Althiburos specimens, respectively. Our results corroborate the introgression of aurochs females into the domestic stock of cattle from Althiburos. 

Methods
Analyses of ancient DNA were conducted in the dedicated ancient DNA (aDNA) facilities at the Centre for Palaeogenetics (CPG), Stockholm University, Sweden. The bone/tooth specimens were submitted to UV sterilisation and removal of ~1 mm from the outermost surfaces with a clean razor blade to eliminate potential surface contaminants.  We obtained approximately 90 mg of bone powder from each specimen using a multitool drill (DremelTM) at low rpm to avoid local heating. Following, we used the Yang et al. (1998) guanidinium/silica-based method for DNA extraction with modifications as in Svensson et al. (2007). Two negative extraction controls were included in every batch of 6 samples. We analysed two overlapping mitochondrial D-loop fragments of 157 bp and 139 bp with the oligonucleotide primer pairs AN2_F: 5’ - GCCCCATGCATATAAGCAAG - 3’/AN1_R: 5’ - CACGCGGCATGGTAATTAAG -3’ (Edwards et al. 2004) and KO1: 5’ - ACCATTAGATCACGAGCTTAA - 3’/KO2: 5’ - GAAGAAAGAACCAGATGCC - 3’ (Anderung et al. 2005), respectively.  Amplification reactions contained 2 μL of genomic DNA, 1x Taq polymerase buffer (Naxo Ltd, Tartu, Estonia), 2.5 mM of MgCl2 (Applied Biosystems), 0.20 mM of each deoxynucleoside triphosphate (dNTP) (Applied Biosystems), 0.4 μM of each PCR primer, 2.5 U of Hot start Taq DNA polymerase (Naxo Ltd, Tartu, Estonia) and PCR water (Qiagen) in a final volume of 25 μL. Amplification conditions were as follows: an initial denaturation/activation step of 95ºC for 15 min; 60 cycles of denaturation at 94ºC (15 s), annealing at 55ºC (30 s for AN2_F/AN1_R) or 57ºC for (30 s for KO1/KO2), and extension at 72ºC (30 s); a final extension step at 72ºC for 10 min. Negative controls were used and all extraction blanks were subject to PCR amplification. Amplifications were verified by the electrophoresis of 5 μL of each PCR product in 2% ethidium bromide agarose gels in Tris/Borate/EDTA (TBE) (0.5x) buffer. Electrophoresis ran at 10V/cm for 30 min. Samples that yielded PCR products of the expected sizes were sequenced following purification with the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer's recommendations. Tagged primers (Binladen et al. 2007) were used for multiplexing in emulsion PCR and individual identification subsequently to 454-sequencing as detailed in Malmström et al. (2009). We used the Quant-iTTM dsDNA High-Sensitivity Assay Kit (Invitrogen) to quantify the purified PCR products, which were then pooled in equimolar mixtures and sequenced on the Genome Sequencer FLX System (Roche).

References:

Anderung, C., Bouwman, A., Persson, P., Carretero, J.M., Ortega, A.I., Elburg, R., Smith, C., Arsuaga, J.L., Ellegren, H., and Gotherstrom, A. (2005). Prehistoric contacts over the Straits of Gibraltar indicated by genetic analysis of Iberian Bronze Age cattle. Proc. Natl. Acad. Sci. U. S. A. 102, 8431–8435. 10.1073/pnas.0503396102.

Binladen, J., Gilbert, M.T., Bollback, J.P., Panitz, F., Bendixen, C., Nielsen, R., and Willerslev, E. (2007). The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing. PLoS One 2, e197. 10.1371/journal.pone.0000197.

Edwards, C.J., MacHugh, D.E., Dobney, K.M., Martin, L., Russell, N., Horwitz, L.K., McIntosh, S.K., MacDonald, K.C., Helmer, D., Tresset, A., et al. (2004). Ancient DNA analysis of 101 cattle remains: Limits and prospects. J. Archaeol. Sci. 31, 695–710. 10.1016/j.jas.2003.11.001.

Malmstrom, H., Gilbert, M.T., Thomas, M.G., Brandstrom, M., Stora, J., Molnar, P., Andersen, P.K., Bendixen, C., Holmlund, G., Gotherstrom, A., et al. (2009). Ancient DNA reveals lack of continuity between neolithic hunter-gatherers and contemporary Scandinavians. Curr Biol 19, 1758–1762. S0960-9822(09)01694-7 [pii]10.1016/j.cub.2009.09.017.

Svensson, E.M., Anderung, C., Baubliene, J., Persson, P., Malmstrom, H., Smith, C., Vretemark, M., Daugnora, L., and Gotherstrom, A. (2007). Tracing genetic change over time using nuclear SNPs in ancient and modern cattle. Anim. Genet. 38, 378–383. AGE1620 [pii]10.1111/j.1365-2052.2007.01620.x.

Yang, D.Y., Eng, B., Waye, J.S., Dudar, J.C., and Saunders, S.R. (1998). Technical note: Improved DNA extraction from ancient bones using silica-based spin columns. Am. J. Phys. Anthropol. 105. 10.1002/(SICI)1096-8644(199804)105:4<539::AID-AJPA10>3.0.CO;2-1.