Table 1 in Encarsia hera Lahey & Andreason (Hymenoptera, Aphelinidae): a charismatic new parasitoid of Aleurocybotus Quaintance & Baker (Hemiptera, Aleyrodidae) from Florida

Table 1. PCR primer sets used in this study. PrimerOrientationRegionSequence (5'-3')ReferenceMChaF1ForwardCOI ACCTCGAATAAATAATATAAGATTFusu and Polaszek 2017HCO2198ReverseTAAACTTCAGGGTGACCAAAAAATCAFolmer et al. 1994LCO1490MForwardCOI BCAACAAATCATAAAGATATTGGFusu and Polaszek 2017; Folmer et al. 1994MChaR1ReverseCCYGTTCCAAYAAATATTCTFusu and Polaszek 2017D23FForward28S-D2-3GAGAGTTCAAGAGTACGTGPark and O’Foighil 2000D3BReverseTCGGAAGGAACCAGCTACTANunn et al. 1996; Whiting et al. 1997Notes: Published as part of Lahey, Zachary, Simmons, Alvin M. & Andreason, Sharon A., 2022, Encarsia hera Lahey & Andreason (Hymenoptera, Aphelinidae): a charismatic new parasitoid of Aleurocybotus Quaintance & Baker (Hemiptera, Aleyrodidae) from Florida, pp. 89 in Journal of Hymenoptera Research 94 on page 89, DOI: 10.3897/jhr.94.94677