Sequencing data for seabird eDNA in long-nosed fur seal diets from southeastern Australia
收藏NIAID Data Ecosystem2026-05-02 收录
下载链接:
http://datadryad.org/dataset/doi%253A10.5061%252Fdryad.stqjq2cb3
下载链接
链接失效反馈官方服务:
资源简介:
Wildlife conflicts require robust quantitative data on incidence and impacts, particularly among species of conservation and cultural concern. We apply a multi-assay framework to quantify predation in a southeastern Australian scenario where complex management implications and calls for predator culling have grown despite a paucity of data on seabird predation by recovering populations of long-nosed fur seals (Arctocephalus forsteri). We apply two ecological surveillance techniques to analyse this predator’s diet – traditional morphometric (prey hard-part) and environmental DNA metabarcoding (genetic) analyses using an avian specific primer for the 12S ribosomal RNA (rRNA) gene – to provide managers with estimated predation incidence, number of seabird species impacted and inter-prey species relative importance to the predator. DNA metabarcoding identified additional seabird taxa and provided relative quantitative information where multiple prey species occur within a sample; while parallel use of both genetic and hard-part analyses revealed a greater diversity of taxa than either method alone. Using data from both assays, the estimated frequency of occurrence of predation on seabirds by long-nosed fur seals ranged from 9.1–29.3% of samples and included up to 6 detected prey species. The most common seabird prey was the culturally valued little penguin (Eudyptula minor) that occurred in 6.1–25.3% of samples, higher than previously reported from traditional morphological assays alone. We then explored DNA haplotype diversity for little penguin genetic data, as a species of conservation concern, to provide a preliminary estimate of the number of individuals consumed. Polymorphism analysis of consumed little penguin DNA identified five distinct mitochondrial haplotypes – representing a minimum of 16 individual penguins consumed across 10 fur seal scat samples from 99 sampled across southeastern Australia. We recommend rapid uptake and development of cost-effective genetic techniques and broader spatiotemporal sampling of fur seal diets to further quantify predation and hotspots of concern for wildlife conflict management.
Methods
Methods (adapted from the manuscript)
Note that the dataset contained herein represents seabird DNA from the 12s ribosomal RNA gene, extracted and collected from 99 long-nosed fur seal faecal (scat) samples from multiple time points and locations across southern New South Wales and Victoria described below, and in greater detail in the associated publication. Here we provide sequenced, demultiplexed and paired-end data in .fastq files, that have been minimally filtered and we highlight the steps taken with these shared data below, and provide further information on how the authors chose to further filter sequences. More processed versions of these data are available upon request.
Site background information
Long-nosed fur seal pups have been recorded (to the best of our knowledge) at Deen Maar Island since 2002, Cape Bridgewater since 2008, Gabo Island since 2016, and Barunguba since 2000 (Arnould et al., 2003; McIntosh et al. unpub. data; Shaughnessy et al., 2001). Pup numbers, as an index of population size in 2013, were ~100 at Cape Bridgewater, ~ 24 at Deen Maar Island (and in 2017), 8 at Gabo Island and ~42 at Barunguba (McIntosh et al., 2014; McIntosh et al. unpublished data) (Illustrated in Figure 1 in Hardy et al. [2024]). Additionally, Phillip Island, in north-central Bass Strait, is home to the largest little penguin colony, with an estimated 31,000 breeding pairs of penguins in 2010 (Sutherland & Dann, 2014). Seabird morphological remains are conspicuous across long-nosed fur seal colonies in southeastern Australia (Illustrated in Figure 2 in Hardy et al. [2024]).
Sample collection
Individual predator scat samples (n = 99) were collected across multiple time points from four long-nosed fur seal breeding colonies in Victorian Bass Strait and New South Wales (NSW), southeastern Australia (Fig. 1 & 2). Pup abundances are illustrated as a conventional proxy for relative seal population abundance (Fig. 1; Appendix S1.1). Most samples were collected from the two larger colonies, Barunguba and Cape Bridgewater, in the Austral spring (September) 2016 and summer (January) 2017, with additional samples included from spring 2015 and summer 2016 at Cape Bridgewater. Samples from Gabo Island were collected from summer 2017. One sample was opportunistically collected from a lactating female at Deen Maar Island and included in assays. Sample sizes resulted from balancing adequate replication per site with availability of fresh samples.
Whole and moist scats were sampled to minimise bias from differential DNA degradation or partial loss of material (similar to Deagle et al., 2009). Whole scats were thoroughly mixed with individual disposable spatulas at point of collection and a 2 mL subsample was taken from each field-homogenised scat for genetic analyses of prey tissues (Hardy et al. 2017). The remaining whole scats were collected for analyses of morphological prey remains, using individual, zip-lock bags. Samples were stored within hours of collection between -10˚ and -20˚C in portable freezers (WAECO) for up to 7 d in the field and transferred to -20˚C freezer facilities.
Identification of seabird genetic remains
For the genetic assay, prey DNA extractions used 250 mg of faecal subsamples and MoBio PowerSoil® DNA Isolation Kits (now QIAGEN: www.qiagen.com) effective for DNA extraction from highly inhibited and mixed samples of faecal origin (similar to Carroll et al. 2019), with modifications to the manufacturer’s instructions made to optimise DNA extraction. These included an overnight digestion phase in cell lysis buffer (C2 solution) at 4˚C, and the incubation step in inhibitor removal solution was extended from 5 to 60 minutes at 4˚C. No host inhibitor step was required because the assays used do not detect mammals. Target DNA was then eluted in 100µL of 10 mM Tris buffer, MoBio PowerSoil® C6 solution, (www.qiagen.com) and stored at -20˚C. DNA extract concentrations were measured and verified using a NanoDrop™ Spectrophotometer (www.thermofisher.com/). For use in positive controls and to test primer specificity, nuclear DNA was extracted from the centre of the muscle tissue matrix (25 mg) of a domestic chicken (Gallus gallus domesticus) and a little penguin carcass obtained by Phillip Island Nature Parks, using Bioline Isolate II Genomic DNA Kits (www.bioline.com/us/) as per manufacturer instructions. A dedicated controlled eDNA laboratory was used at RMIT University, Bundoora, Victoria, with separate spaces and rooms designated for the physical separation of eDNA extraction, pre-PCR preparations and post-PCR procedures. Positive and negative controls (extraction and PCR) were used to identify potential contamination at each laboratory procedural step from DNA extraction to diagnostic PCR steps.
The 99 faecal DNA sample extracts were screened in duplicate and at two DNA concentrations (neat and 1:10 dilutions), alongside extraction blanks (n = 5), PCR blanks (n = 4), and positive controls (n = 2) by diagnostic endpoint PCR (dPCR) using the Bird12sa/h assay (forward 5’ CTGGGATTAGATACCCCACTAT to 3’, reverse 5’ CCTTGACCTGTCTTGTTAGC to 3’), a conservative primer ‘Bird12sa/h’ targeting a ~230 base pair (bp) fragment of the avian 12S ribosomal RNA (rRNA) gene (Cooper, 1994) (Table 1). PCRs were run on Bio Rad C1000 Touch thermal cycler using cycling steps outlined in Table S2, and using the AmpliTaq Gold® 360 Master Mix using reagents and concentrations provided by the manufacturers. All duplicate dPCR products were run on 1.5% agarose gels to determine the presence/absence of amplified target bird DNA. We obtained optimal amplification and low inhibition from neat DNA concentrations.
Using the avian specific Bird12sa/h assay, a total of 32 samples (of 99) showed target amplicons in both or a single duplicate at neat DNA concentration, all extraction and PCR controls were negative. DNA extracts of the 32 samples that tested positive for birds, and two extraction blanks and one positive control (n = 35 samples for sequencing) were therefore sent for quantitative PCR (qPCR), cleanup, sample-based rarefaction and extrapolation sampling curves, appropriate sequencing depth (< 10,000 reads per sample) and next generation sequencing performed on Illumina Miseq by Ramaciotti Centre for Genomics (RCG), University of New South Wales. There, a single-step fusion tagging PCR procedure was used to attach and assign unique MID (Multiplex IDentifier) tag combinations, next generation sequencing (NGS) adaptors and the Bird12sa/h assay. Amplicons were purified and blended at RCG in equimolar concentrations to form a library, which was sequenced with a 150 bp paired-end sequencing kit (Illumina Miseq v2 Nano 150 bp). We used the single-step fusion PCR procedure over the two-step PCR approach to reduce the risk of ‘tag jumping’ during the second amplification step where MID tags are assigned (Taberlet et al., 2018, Schnell et al., 2015). This type of error is difficult to detect and risks cross-contamination of amplified DNA among samples between initial PCR products and terminal PCR products. Single-step fusion PCR procedures therefore provide us with the least risk of sample cross-contamination over other procedures. After sequencing, samples were ‘demultiplexed’ and assigned to the correct original sample by their individual MID tags.
We used Geneious R8.1.5 (Kearse et al., 2012) to merge the paired-end forward and reverse sequences (2x ~150 bp fragments, with overlap of 70 bp) and retain only those with exact flanking MID tags, primers, and adapter sequences. Once paired, the MID tags, NGS adaptor sequences and the Bird12sa/h forward and reverse primers, were subsequently trimmed, leaving the complete target sequences for each sample. Sequences were discarded if they did not contain exact matches to both the forward and reverse PCR primers, tags, and adaptor sequences, failed to pair, or were > 10% shorter than the primer product length (expected 220 bp, discarded below 200 bp) (as in Berry et al., 2017, and Hardy et al., 2017). The data contained within the .fastq files shared herein have been processed up until this point. Below we include information on the next steps that we took with these data, but we chose to share the rawer pre-filtered version of these data in order to allow future users to filter and quality control to their preferred methods and standards.
Further sequence quality filtering
These sequences were quality filtered and clustered into molecular operational taxonomic units (OTUs) using the UPARSE algorithm in USEARCH (Edgar, 2010; Edgar & Flyvbjerg, 2015) and using a 97% similarity criterion (as in Berry et al., 2017). Illumina’s Miseq has been found to have an error rate of about 0.1% (Fox et al. 2014), we chose a conservative 1% cut off of aggregated 100% identical, unique nucleotide sequences (hereafter ‘unique sequences’) to further minimises the risk of erroneous sequences and false positives. We then mapped total filtered sequences (hereafter retained reads or sequences) for these identified OTUs back to individual samples. This can result in some samples containing very low to trace amounts of retained target sequences of high quality that belong to a more abundant cluster from the pool across samples.
Consensus, representative sequences for each out were queried against the National Center for Biotechnology Information’s (NCBI) GenBank nucleotide database using the algorithm BLASTn (Basic Local Alignment Search Tool; Benson et al., 2005). The resulting queried sequences were assigned to taxa, following criteria and taxonomic reference databases outlined in Hardy et al. (2017) and Appendix S1.4 (Table S3). These criteria maximised confidence in making a taxonomic identification by remaining conservative in our assignments (i.e., selecting an identification at genus level) where multiple species were found to be closely related on the Bird12s gene, or where other likely and related prey lacked genetic reference material, which could lead to false assignment to a genetically related taxon with representative genetic reference material. All the identified seabirds occurred within the geographic ranges of the LNFS and are considered viable prey species for LNFS.
Statement of Animal Ethics Approval & Permits for Sampling
Samples from NSW were collected for another project and sub-samples were submitted to Phillip Island Nature Parks for screening of bird DNA. Samples from NSW were collected under University of Sydney ethics permit (L04/9-2013/4/6056); Australian Government permits to conduct research under the EPBC Act (AU-COM2013-224), and from the Office of Environment and Heritage NSW Scientific License (SL101244). Victorian research was performed under Phillip Island Nature Parks Ethics Permit (2.2016) and Department of Environment, Land, Water and Planning Research Permit (10007974). We acknowledge the following Nations and Traditional Owners on whose unceded lands we conducted this research: Yuin (Barunguba), Bunurong (Millowl, Phillip Island), Gunditjmara (Cape Bridgewater and Deen Maar Island), Eastern Maar (Deen Maar Island), Kulin (RMIT Bundoora) and Eora (USYD).
Literature Citations From Methods
Arnould, J. P. Y., Boyd, I. L., & Warneke, R. M. (2003). Historical dynamics of the Australian fur seal population: Evidence of regulation by man? Canadian Journal of Zoology. doi.org/10.1139/z03-134
Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., & Wheeler, D.L. (2005). GenBank. Nucleic Acids Research 33: suppl_1, D34–D38. doi.org/10.1093/nar/gki063
Berry, T E., Osterrieder, S.K., Murray, D.C., Coghlan, M.L., Richardson, A.J., Grealy, A.K., Stat, M., Bejder, L., & Bunce, M. (2017). DNA metabarcoding for diet analysis and biodiversity: A case study using the endangered Australian sea lion (Neophoca cinerea). Ecology and Evolution 7:14, 5435–5453. doi.org/10.1002/ece3.3123
Carroll, E. L., Gallego, R., Sewell, M. A., Zeldis, J., Ranjard, L., Ross, H. A., Tooman, L. K., O’Rorke, R., Newcomb, R. D. & Constantine, R. (2019). Multi-locus DNA metabarcoding of zooplankton communities and scat reveal trophic interactions of a generalist predator. Scientific Reports, 9(1), 1-14.
Cooper, A. (1994). DNA from Museum Specimens. In B. Herrmann & S. Hummel (Eds.), Ancient DNA: Recovery and Analysis of Genetic Material from Paleontological, Archaeological, Museum, Medical, and Forensic Specimens (pp. 149–165). Springer. doi.org/10.1007/978-1-4612-4318-2_10
Deagle, B. E., Kirkwood, R., & Jarman, S. N. (2009). Analysis of Australian fur seal diet by pyrosequencing prey DNA in faeces. Molecular ecology, 18(9), 2022-2038.
Edgar, R.C. (2010). Search and clustering orders of magnitude faster than BLAST. Bioinformatics, 26:19, 2460–2461. doi.org/10.1093/bioinformatics/btq461
Edgar, R.C., & Flyvbjerg, H. (2015). Error filtering, pair assembly and error correction for next-generation sequencing reads. Bioinformatics 31:21, 3476–3482. doi.org/10.1093/bioinformatics/btv401
Fox, E. J., Reid-Bayliss, K. S., Emond, M. J. & Loeb, L. A. (2014). Accuracy of Next Generation Sequencing Platforms. Next Generation Sequencing & Applications, 1.
Hardy, N., Berry, T., Kelaher, B. P., Goldsworthy, S. D., Bunce, M., Coleman, M. A., Gillanders, B. M., Connell, S. D., Blewitt, M., & Figueira, W. (2017). Assessing the trophic ecology of top predators across a recolonisation frontier using DNA metabarcoding of diets. Marine Ecology Progress Series, 573, 237–254. doi.org/10.3354/meps12165
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., & Drummond, A. (2012). Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:12, 1647–1649. doi.org/10.1093/bioinformatics/bts199
McIntosh, R. R., Sutherland, D. R., Dann, P., Kirkwood, R., Thalman, S., Alderman, R., Arnould, J. P., Mitchell, T., Kirkman, S., Salton, M., & Slip, D. (2014). Pup estimates for Australian and New Zealand fur seals in Victoria, Tasmania and New South Wales between 2007 and 2013 (Final Report to The Australian Marine Mammal Centre, Department of Environment, Australian Government, 95pp.)
Schnell IA, Bohmahh K, Gilbert TP. (2015) Tag jumps illuminaated – reducing sequence-to-sample misidentifications in metabarcoding studies. Molecular Ecology Resources. 15, 1289-1303.
Shaughnessy, P. D., Briggs, S. V., & Constable, R. (2001). Observations on Seals at Montague Island, New South Wales. Australian Mammalogy, 23(1), 1–7. doi.org/10.1071/am01001
Sutherland, D. R., & Dann, P. (2014). Population trends in a substantial colony of Little Penguins: Three independent measures over three decades. Biodiversity and Conservation, 23(1), 241–250. doi.org/10.1007/s10531-013-0597-y
Taberlet, P., Brown, A., Zinger, L., and Coissac, E. (2018). Environmental DNA for Biodiversity Research and Monitoring. Oxford University Press, Oxford, United Kingdom.
创建时间:
2024-05-17



