Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula

In this study we use sedimentary ancient DNA metabarcoding from two marine
sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at
western Fram Strait (subarctic North Atlantic) from which we collected 12
samples including one biological replicate. The second Kastenlot core
SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific)
from which we collected 9 samples and 2 samples were collected from a
pilot core taken next to the Kastenlot core. Total DNA was extracted from
approximately 2ml sediment per sample in 3 batches with up to 9 samples
and one extraction blank. Total DNA was concentrated and if necessary
diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates
including a PCR no template control (NTC). We amplified a diatom-specific,
76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F
(AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R
(TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in
equal concentrations. The sequencing library was prepared with the Mid
Output kit v. 2 according to the Fasteris Metafast protocol for low
complexity amplicon sequencing and checked by qPCR. The library was
sequenced (2 x 150 bp, paired-end) on the Illumina NextSeq 500 at the
Fasteris SA sequencing service (Switzerland). For two samples we sequenced
4 PCR-products and for two samples we could only get 2 PCR-products with
sufficient DNA content for sequencing.