Eutreptiella sp. ''Long Island Sound 2002'' Transcriptome or Gene expression

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood regarding their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp.. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing.