rCRUX Generated ITS2 Plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  ITS2 Plants
Gene:   ITS2
Length of Target:    450-550
get_seeds_local() minimum length:    315
get_seeds_local() maximum length:    600
blast_seeds() minimum length:    270
blast_seeds() maximum length:    560
max_to_blast:  100
Forward Sequence (5'-3'):   ATGCGATACTTGGTGTGAAT
Reverse Sequence (5'-3'):    GACGCTTCTCCAGACTACAAT
Reference:    Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... & Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. https://doi.org/10.1371/journal.pone.0067818

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.