Analysis of Drosophila melanogaster nascent transcription start sites

To identify TF binding motifs with position-dependent functions associated with transcription initiation, we performed csRNA-seq to map initiating transcripts in Drosophila melanogaster embryos. We started with cell culturing and csRNA-seq for data acquisition. This was followed by a csRNA-seq bioinformatics analysis comparing TSS with more vs. less nascent transcription. Overall design: Fly cell culture and treatment Canton S wild-type Drosophila melanogaster flies were grown at 25°C at 70-80% humidity in population cages. The embryos were collected on molasses-agar plates covered with yeast. Library prep and csRNA-seq on fly cells CsRNA-seq was performed on embryonic (0-12h) Drosophila melanogaster cells as previously described (Duttke et al., 2019). TSS quantification from csRNA-seq First, 3' adapters were cut using the the following command: homerTools trim -3 AGATCGGAAGAGCACACGTCT -mis 2 -minMatchLength 4 -min 20 {reads.fastq.gz} Where {reads.fastq.gz} stands in for the actual read file. Then the trimmed reads were aligned to the dm6 reference genome using the STAR aligner, with splice junctions informed by the corresponding Ensemble Genes GTF file available from UCSC (Dobin et al., 2013; Howe et al., 2021). The read alignments were converted into tag directories using HOMER. A HOMER script, getTSSfromReads.pl, was then used to identify individual TSS from the assay from the 5' ends of the aligned reads, and score them by their coverage. The resulting TSS file was converted to a scored bed file using awk, and coverage scores were transformed using the function log2(x+1), where x was the original score.