Soil biogeochemical properties of Robinia pseudoacacia plantations under different forest management measures on the Loess Plateau
收藏资源简介:
We implemented four management practices for R. pseudoacacia plantations on the Loess Plateau from 2020 to 2023: control (CK); understory vegetation removal (UR); thinning (TH); and thinning with understory vegetation removal (TUR). We monitored soil temperature, soil moisture, and soil respiration in the plantation forest during the experiment and determined basic soil physical and chemical properties and microbial community characteristics.In April 2021, polyvinyl chloride (PVC) respiration rings were inserted into the soil at a depth of 10 centimeters at each replicate plot and remained in the same position throughout the experiment. The rings were 13 cm in height and had an inner diameter of 20 cm. The Li-8100 (LI-COR Inc., Lincoln, NE, USA) was employed to measure soil respiration on a monthly basis from May to November during the 2021−2023 experiment. We employed scissors to extract live plants from the respiration ring prior to each measurement. In order to mitigate the impact of weather on soil respiration, each soil respiration measurement was conducted on a sunny day between 10:00 and 14:00 local time. Simultaneously, the Li-8100 instrument was employed to measure soil temperature (ST) and soil water content (SWC) at a depth of 10 cm near each PVC ring. This was accomplished using a portable soil temperature and moisture probe.Total soil DNA was extracted from 0.5 g of soil using the FastDNA Spin kit (MP Biomedicals, USA). Primers 341F (CCTAYGGGRBGCASCAG) and 806R (GGACTACNNGGGTATCTAAT) were employed to amplify the V3-V4 region of the bacterial 16S rRNA gene. The ITS1-5F region of fungi was amplified using primers 1737F (GGAAGTAAAAGTCGTAACAAGG) and 2043R (GCTGCGTTCTTCATCGATGC). The Illumina NovaSeq platform from Novogene, Beijing, was employed to conduct the sequencing.



