List of target sequences for NanoString probes.

The table provides an overview of all NanoString probes. It shows the 100 bp long target sequences that were used for the design of the NanoString probes in the LT-experiment. Additionally, the table shows the sequences of probe A and probe B used in the ST-experiments. Probe A includes 50 nt of the target sequence and the sequence that attaches to the row-specific fluorophore. The sequences for probe B include 50 bp of the target sequence and a short universal sequence for the capture probe (CGAAAGCCATGACCTCCGATCACTC). (XLSX)