SNCA targeted cDNA: PacBio Iso-Seq raw data
收藏资源简介:
<strong>The landscape of <em>SNCA</em> transcripts across </strong><strong>synucleinopathies</strong><strong>: New insights from long reads sequencing analysis</strong> <strong>cDNA capture using IDT xGen</strong><strong>® Lockdown</strong><strong>® Probes and single-molecule Isoform-Sequencing (Iso-Seq)</strong> 100-150ng of total RNA per reaction was reverse transcribed using the Clontech SMARTer cDNA synthesis kit and 12 sample specific barcoded oligo dT (with PacBio 16mer barcode sequences, see Supplementary Methods). Three reverse transcription (RT) reactions were processed in parallel for each sample. PCR optimization was used to determine the optimal amplification cycle number for the downstream large-scale PCR reactions. A single primer (primer IIA from the Clontech SMARTer kit 5’ AAG CAG TGG TAT CAA CGC AGA GTA C 3’) was used for all PCR reactions post-RT. Large scale PCR products were purified separately with 1X AMPure PB beads and the bioanalyzer was used for QC. An equimolar pool of 12-plex barcoded cDNA library (1µg total) was input into the probe based capture with a custom designed SNCA gene panel. A SMRTBell library was constructed using 874ng of captured and re-amplified cDNA (https://www.pacb.com/wp-content/uploads/Procedure-Checklist-%E2%80%93-cDNA-Capture-Using-IDT-xGen-Lockdown-Probes.pdf). One SMRT Cell (6 hour movie) was sequenced on the PacBio Sequel platform using 2.0 chemistry. The 5’ primer is identical for all patient samples: AAGCAGTGGTATCAACGCAGAGTACATGGG The 3’ primer for the 12 patient samples are below: PD-1: CGCACTCTGATATGTGGTACTCTGCGTTGATACCACTGCTT PD-2: CTCACAGTCTGTGTGTGTACTCTGCGTTGATACCACTGCTT PD-3: CTCTCACGAGATGTGTGTACTCTGCGTTGATACCACTGCTT PD-4: CGCGCGTGTGTGCGTGGTACTCTGCGTTGATACCACTGCT N-1: ACGCGAGAGTCGAGTGGTACTCTGCGTTGATACCACTGCTT N-2: ACAGCTGATATATATGGTACTCTGCGTTGATACCACTGCTT N-3: CACATAGAGATACAGAGTACTCTGCGTTGATACCACTGCTT N-4: CGCAGCGCTCGACTGTGTACTCTGCGTTGATACCACTGCTT DLB-1: TCTGTCTCGCGTGTGTGTACTCTGCGTTGATACCACTGCTT DLB-2: CTCTGAGATAGCGCGTGTACTCTGCGTTGATACCACTGCTT DLB-3: ATAGATATACGTATAGGTACTCTGCGTTGATACCACTGCTT DLB-4: ACACGCGATCTAGTGTGTACTCTGCGTTGATACCACTGCTT



