Surface swabs outperform most traditional honeybee (Apis mellifera) hive samples for recovery of eDNA and eRNA

Raw data files, analysis scripts and input files to generate data presented in the manuscript\nLineage: DNA and RNA was collected from honeybee hives to compare taxonomic composition derived from different sample types (hive entrance swabs (DNA/RNA), hive debris swabs (DNA), honey (DNA/RNA), internal pollen (DNA/RNA), pollen traps (DNA), top box bees (DNA/RNA), and return forager bees (DNA)), using a DNA metabarcoding and RNA metatranscriptomic approach.\nDNA samples were amplified and sequenced on an Illumina MiSeq v3 600 cycle run. Metabarcoding primers used were:\nBacteria (16S):\n515-FY GTGYCAGCMGCCGCGGTAA\n806R GGACTACNVGGGTWTCTAAT\nAnimal (COI):\nFwhF2 GGDACWGGWTGAACWGTWTAYCCHCC\nFwhR2n GTRATWGCHCCDGCTARWACWGG\nAmel_PNA (honeybee blocking primer) CATTCTTCACCTTCAGTAGA\nFungi (ITS1):\nITS1f CTTGGTCATTTAGAGGAAGTAA\nITS2r GCTGCGTTCTTCATCGATGC\nPlant (ITS2):\nS2F ATGCGATACTTGGTGTGAAT\n4rev TCCTCCGCTTATTGATATGC\nRNA samples were sequenced using a NextSeq 2000 P2 2 x 150 bp run.