Data from: Optimizing detectability of the endangered fan mussel using eDNA and ddPCR
收藏Mendeley Data2024-04-13 更新2024-06-27 收录
下载链接:
https://datadryad.org/stash/dataset/doi:10.5061/dryad.jh9w0vtj8
下载链接
链接失效反馈官方服务:
资源简介:
Assay development Reference sequences on the mitochondrial genome were downloaded for P.nobilis and co-occurring related species of the same family (Pinna rudis and Atrina fragilis) from EMBL (Kanz et al. 2005), and aligned using Geneious Prime 2020 (https://www.geneious.com/). Primer selection was done by maximizing specificity on the binding sites for the target species while maximizing the number of mismatches of ligation sites of closely related species. Primers were designed manually with the assistance of the primer3 algorithm on Geneious and amplified a sequence insert of ~202 bp on the mitochondrial COI gene for P.nobilis (Supl Mat Table S1), the full amplified sequence being ~243 pb. The selected primer pair (PN_COI_M15; forward-TCAGCTTTTGTAGAGGGCGG; reverse- AGAGACTACCAACAGCACAGC) was also tested on the entire NCBI database using in-silico PCR with the ecoPCR software (Boyer et al., 2016) allowing up to 3 mismatches on each primer (so 6 in total), to verify the absence of unrelated species cross-amplification. Additionally, a probe (PN_COIM15-Probe; FAM-5’ TGGATTTGTTCCCTTGGGCTGTTC 3’- BHQ1) was designed to enhance specificity using the Primer3Plus software (Untergasser et al. 2012). Sampling for eDNA DNA sampling aimed to first collect live fan mussel from an aquarium and then sample water in real field condition in a Mediterranean lagoon with known populations of fan mussel. We sampled water in the field with known presence and densities of fan mussels in the Thau lagoon (Sète, France) (Foulquie et al. 2020), one of the last known locations to harbor healthy mussel populations in France. Sampling sites were chosen from the study of Foulquie et al. (2020) which assessed fan mussel densities in several sites around the lagoon 3 months prior to our sampling. We selected sites with at least 3m of depth and varying densities: the Barrou (~9 ind/100m2) and the Sete Canal (~4 ind/100m2) (Fig. 1). Maximum depth of those sites was ~2.5m. We filtered water from a boat using the same pump and settings as for the aquaria samples but made linear transects of ~300m over the site area, for a total of 30L per sample. Transects were made at low speed (5 knots) and by going back and forth to remain in the area, with one pump on each side of the boat and using disposable tubing and gloves. Surface samples were done at ~0.5m of the surface with short tubes, and deeper samples were done to target the benthos using 3m-long weighted tubes. We chose to sample seasonally during Summer and Autumn to encompass various environmental conditions and test a potential effect of the reproduction period, known to occur during the summer months. We collected a total of 48 samples, with 24 samples over two days in summer in July (2020-07-27 and 2020-07-30), and 24 samples over two days in autumn in October (2020-10-20 and 2020-10-21). Each day, 12 samples were collected spanning both sites and two sampling depths (bottom and surface), so that three replicates were obtained for each site-depth combination. eDNA extraction and amplification by ddPCR DNA extraction DNA extraction was performed at SPYGEN (Le Bourget du Lac, France) following the protocol described in Polanco Fernández et al., (2020), in a dedicated lab for eDNA extraction with UV treatment and positive air pressure. Briefly, each capsule was agitated for 15 min on an S50 shaker (cat Ingenieurbüro™) at 800 rpm. The buffer was then emptied into two 50-ml tubes before being centrifuged for 15 min at 15,000 g. The supernatant was removed with a sterile pipette, leaving 15 ml of liquid at the bottom of each tube. Then, 33 ml of ethanol and 1.5 ml of 3 M sodium acetate were added to each 50-ml tube and stored for at least one night at −20°C. The tubes were centrifuged at 15,000 g for 15 min at 6°C, and the supernatants were discarded. After this step, 720 μl of ATL buffer from Qiagen Blood and Tissue Kit(Qiagen GmbH) was added to each tube. Each tube was then vortexed, and the supernatant was transferred to a 2-ml tube containing 20 μl of Proteinase K. The tubes were finally incubated at 56°C for 2 hr. Subsequently, DNA extraction was performed using NucleoSpin® Soil (MACHEREY-NAGEL GmbH & Co.) starting from step 6 and following the manufacturer's instructions, and two DNA extractions were carried out per filtration capsule. The elution was performed by adding 100 μl of SE buffer twice. The two DNA samples were pooled before the amplification step. After the DNA extraction, the samples were tested for inhibition by qPCR (Biggs et al. 2015). If the sample was considered inhibited, it was diluted 5-fold before amplification. Amplification with ddPCR ddPCRs were run with a BioRad QX200 Droplet Digital PCR system™ (Bio-Rad, Temse, Belgium). Each 22 μl ddPCR reaction mix contained 1× Bio-Rad ddPCR supermix for probes (no dUTP), 900 nM forward primer, 900 nM reverse primer, 250 nM probe, 2,5 μl template, and 3,99 μl H20. ddPCR reaction was placed in a QX200 Droplet Generator to generate approximately 20000 droplets in which independent PCR reactions occur.PCR was performed with the following thermal conditions: 95°C for 10 min followed by 40 cycles of 95°C for 30s and 58°C for 1 min; and 98°C for 10 min and 4°C for 30 min. Optimal annealing temperature (58°C) was determined based on an initial thermal gradient experiment testing temperatures from 54 to 64°C. Droplets were then read on a QX200 droplet reader (Bio-Rad). Each run included 3 PCR positive and 3 PCR negative controls and samples were tested in triplicate (N=3). QuantaSoft software was used to count the PCR-positive and PCR-negative droplets and to provide absolute quantification of target DNA. The baseline threshold for separating positive and negative droplets was manually chosen per run, based on the distribution of the negative droplets from the negative control wells. The quantification measurements of each target were expressed as the copies number per 1 μl of reaction. Analysis Amplification results from ddPCR were analyzed both considering the number of positive replicates among the 3 replicates per sample and quantitatively using the number of copies per µL. Repeatability by sample between the PCR replicates was assessed with the R package rptR (Stoffel et al. 2017). The average number of copies per µL measured with ddPCR were related to site, depth and season using a General Linear Model (GLM). We used a Poisson distribution to model the average number of copies per µL among the 3 replicates for each sample. We added a dummy variable representing a putative reproduction event on a particular summer sampling day.
创建时间:
2024-01-08



