Knockdown of transcription factor Creb3l1 in anterior pituitary mouse corticotroph cell line AtT20

Transcription factor Creb3l1 is a non-classical ER stress molecule that is emerging as an important component for cellular homeostasis, particularly within cell-types with high peptide secretory capabilities. We have previously shown that Creb3l1 serves an important role in body fluid homeostasis through its transcriptional control of the gene coding for antidiuretic hormone arginine vasopressin in the neuropeptide rich magnocellular neurons of the supraoptic nucleus. To identify other genes regulated by transcription factor Creb3l1 in secretory cells, we performed RNA-sequencing of Creb3l1 knockdown anterior pituitary mouse corticotroph cell line AtT20. Overall design: Total RNA was extracted from AtT20/D16v-F2 cells stably transduced with lentivirus expressing Creb3l1 shRNA (GAGTCGGATTTCCTCAACAAT) or non-targeting control shRNA (ATCATGTTAGGCGTACGGACT). RNA samples (n=5 each group) were sent for RNA sequencing.