Taxon pulse dynamics, episodic dispersal, and host colonization across Beringia drive diversification of a holarctic tapeworm assemblage
收藏NIAID Data Ecosystem2026-03-12 收录
下载链接:
http://datadryad.org/dataset/doi%253A10.5061%252Fdryad.rxwdbrv61
下载链接
链接失效反馈官方服务:
资源简介:
Aim: We test the predictions of the Stockholm Paradigm, a synthesis of eco-evolutionary theory explaining the nature of faunal assembly, host range and parasite diversification. Faunal diversification and assembly, manifested in patterns of host colonization, co-adaptation and parasite speciation, is predicted to emerge as a consequence of alternating episodes of ecological disruption and stability. Specifically, for a diverse cestode genus (Arostrilepis), we evaluate the number and direction of Pleistocene dispersal events across Beringia, the number and relative timing of host colonization events, and the relationship between host and parasite biogeographic histories and associations through time.
Location: Beringia and adjacent temperate to arctic biomes in North America and Eurasia.
Taxon: Arostrilepis (Cyclophyllidea: Hymenolepididae) and its rodent hosts.
Methods: Multi-locus phylogenetic reconstruction and biogeographic ancestral range estimation.
Results: Arostrilepis lineages crossed Beringia eastward into North America a minimum of four times and westward into Asia twice in association with temporally disjunct geographic expansions of three major tribes of cricetid rodents (Arvicolini, Myodini, Lemmini). Inferences of ancestral host associations support at least nine instances of host-colonization involving shifts from one rodent tribe or family to another. Several previously unrecognized lineages of Arostrilepis are revealed.
Main conclusions: Consistent with expectations of the Stockholm Paradigm, episodes of intercontinental dispersal were both frequent in the history of Arostrilepis and preceded a majority of inferred host-colonization events. Events of historical geographic expansion created numerous opportunities for development of novel host-parasite associations through ecological fitting, as parasites tracked historically conserved resources available across diverse host taxa. Beringia played a major role in shaping rodent/parasite assemblages by mediating dispersal between the northern continents during glacial episodes of the Pleistocene, rather than by serving as a zone of refugial isolation.
Methods
Whole genomic DNA was extracted from 3-10 posterior proglottids from individual tapeworms using a Qiagen™ DNeasy Tissue Kit®. These templates were used to PCR-amplify and sequence four genomic regions: 1) a portion of the mitochondrial cytochrome b (CYTB; ~570 base pairs), 2) subunit I of the mitochondrial NADH dehydrogenase complex (ND1; ~780 base pairs), 3) nuclear 28S ribosomal RNA (28S; ~1340 base pairs), and 4) a portion of the 5.8s region and the second internal transcribed spacer of nuclear ribosomal DNA (ITS2; ~740 base pairs).
We amplified the four markers using the following primers – CYTB: HYM01 paired with either HYM08, HYMLEM02 (Makarikov et al., 2013), or HYM24 (5’GGATTATTACTACCTCTCTTATGCAAAT); ND1: Cyclo_nad1F and Cyclo_trnNR (Littlewood, Waeschenbach, & Nikolov, 2008); 28S: LSU5 and 1200R (Littlewood, Curini-Galletti, & Herniou, 2000; Lockyer, Olson, & Littlewood, 2003); and ITS2: 3S and A28 (Okamoto, Agatsuma, Kurosawa, & Ito, 1997). Annealing temperatures were 50ºC for CYTB and ITS2, 45ºC for ND1, and 52ºC for 28S. Most ITS2 products were cloned using 1/3 volume reactions of Invitrogen’s™ Topo TA Cloning® kit with pCR®2.1-TOPO® vector. We sequenced between 4 and 8 separate clones from each specimen and determined the consensus sequence of the most frequently cloned allele. For all markers, PCR products were sequenced in both directions and assembled using Geneious® v6.
Two species, A. rauschorum Makarikov, Galbreath et Hoberg, 2013 and Arostrilepis microtis Gulyaev et Chechulin, 1997, were previously reported to contain NUMTs (Makarikov et al., 2013). To efficiently separate mitochondrial sequence from putative nuclear sequence, we designed primers to target only mitochondrial sequence during CYTB amplification. These targeted primer pairs were HYM29 (5’TGATTAATATTATACGACGT) and HYM30 (5’TGTGCAAATAAAATAAATGT) for probable A. rauschorum, and HYM32 (5’AATGTAAAAACATTAAGCCC) and HYM33 (5’TACGACGTAATTTAATTGAT) for probable A. microtis (50ºC annealing).
Data from GenBank supplemented our molecular dataset. For Arostrilepis species, 37 CYTB sequences (Galbreath, Ragaliauskaitė, Kontrimavichus, Makarikov, & Hoberg, 2013; Makarikov et al., 2020; Makarikov et al., 2013), two ND1 sequences (Binkiene, Kornienko, & Tkach, 2015), three 28S sequences (Haukisalmi et al., 2010), and 12 ITS2 sequences (Galbreath et al., 2013; Makarikov et al., 2020) were assembled from previously published datasets. These sequences are derived from specimens whose species identities have been morphologically validated, providing a reference for confirming identifications based on genetic identity. No fresh tissue or sequence data are currently available from four species, Arostrilepis horrida (Linstow, 1901), Arostrilepis kontrimavichusi Makarikov et Hoberg, 2016, Arostrilepis mariettavogeae Makarikov, Gardner et Hoberg, 2012, and Arostrilepis schilleri Makarikov, Gardner et Hoberg, 2012. We also acquired sequences representing Hymenolepis diminuta (Rudolphi, 1819), Hymenolepis folkertsi, Lineolepis scutigera (Dujardin, 1845), Neoskrjabinolepis schaldybini Spassky, 1947, Soricinia infirma (Zarnowski, 1955), and Staphylocystis furcata (Stieda, 1862) from GenBank for use as outgroups.
Assembled DNA datasets were aligned using MUSCLE (Edgar, 2004) as implemented in MEGA v7 (Kumar, Stecher, & Tamura, 2016), and edited by eye. Sites with gaps in the ingroup taxa were excluded from the analysis, as were regions of ambiguous alignment. Ambiguous alignment was most severe in the ITS2 dataset, especially between outgroup species and Arostrilepis. To mitigate this without losing informative variation within the ingroup sequences, ITS2 sequences for Hymenolepis diminuta, Staphylocystis furcata, and Lineolepis scutigera were truncated to include only the relatively conserved 5.8S portion of the sequence.
References:
Binkiene, R., Kornienko, S. A., & Tkach, V. V. (2015). Soricinia genovi n. sp. from Neomys fodiens in Bulgaria, with redescription of Soricinia globosa (Baer, 1931) (Cyclophyllidea: Hymenolepididae). Parasitology Research, 114, 209-218. doi:10.1007/s00436-014-4180-6
Galbreath, K. E., Ragaliauskaitė, K., Kontrimavichus, V. L., Makarikov, A. A., & Hoberg, E. P. (2013). A widespread distribution for Arostrilepis tenuicirrosa (Eucestoda: Hymenolepididae) in Myodes voles (Cricetidae: Arvicolinae) from the Palearctic based on molecular and morphological evidence: historical and biogeographic implications. Acta Parasitologica, 58, 441-452.
Haukisalmi, V., Hardman, L. M., Foronda, P., Feliu, C., Laakkonen, J., Niemimaa, J., . . . Henttonen, H. (2010). Systematic relationships of hymenolepidid cestodes of rodents and shrews inferred from sequences of 28S ribosomal RNA. Zoologica Scripta, 39, 631-641. doi:10.1111/j.1463-6409.2010.00444.x
Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. Molecular Biology and Evolution, 33, 1870-1874. doi:10.1093/molbev/msw054
Littlewood, D. T., Waeschenbach, A., & Nikolov, P. (2008). In search of mitochondrial markers for resolving the phylogeny of cyclophyllidean tapeworms (Platyhelminthes, Cestoda) — a test study with Davaineidae. Acta Parasitologica, 53, 133-144. doi:10.2478/s11686-008-0029-4
Littlewood, D. T. J., Curini-Galletti, M., & Herniou, E. A. (2000). The interrelationships of Proseriata (Platyhelminthes: Seriata) tested with molecules and morphology. Molecular Phylogenetics and Evolution, 16, 449-466. doi:https://doi.org/10.1006/mpev.2000.0802
Lockyer, A. E., Olson, P. D., & Littlewood, D. T. J. (2003). Utility of complete large and small subunit rRNA genes in resolving the phylogeny of the Neodermata (Platyhelminthes): implications and a review of the cercomer theory. Biological Journal of the Linnean Society, 78, 155-171. doi:10.1046/j.1095-8312.2003.00141.x
Makarikov, A. A., Galbreath, K. E., Eckerlin, R. P., & Hoberg, E. P. (2020). Discovery of Arostrilepis tapeworms (Cyclophyllidea: Hymenolepididae) and new insights for parasite species diversity from Eastern North America. Parasitology Research, 119, 567-585. doi:10.1007/s00436-019-06584-4
Makarikov, A. A., Galbreath, K. E., & Hoberg, E. P. (2013). Parasite diversity at the Holarctic nexus: species of Arostrilepis (Eucestoda: Hymenolepididae) in voles and lemmings (Cricetidae: Arvicolinae) from greater Beringia. Zootaxa, 3608, 401-439. doi:10.11646/zootaxa.3608.6.1
Okamoto, M., Agatsuma, T., Kurosawa, T., & Ito, A. (1997). Phylogenetic relationships of three hymenolepidid species inferred from nuclear ribosomal and mitochondrial DNA sequences. Parasitology, 115, 661-666.
创建时间:
2020-12-08



