Closing the gap in C. sinica D-loop region using Nanopore sequencing

C. sinica D-loop region was first amplified by nest PCR using the genomic DNA extracted from the strain JU727 as template. The primer sequences for the first round of PCR were F: TCGGTCTTCCTCACTTTT and R: TCTTAGCAACCCAAATGC. The primer sequences for the second round of PCR were F: TAAGGGTTATACCTTATTTTTAAG, R: ATTAAACTATTTACTGAAAACCA. Because the resulting PCR products contained multiple bands with subtle difference in sizes even after multiple attempts in PCR parameter tuning, it is not possible to resolve the D-loop sequence by Sanger sequencing. Nanopore sequencing technique was used to directly sequence the PCR products. Specifically, the PCR products were size-selected by gel purification for bands approximately 490 bp in size, which were used for making sequencing library using 1D ligation gDNA kit (SQK-LSK108). The library was sequenced on a Nanopore MinION sequencer with R9.4 flow cell (FLO-MIN106).