rCRUX Generated Fungal ITS Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  Fungal_ITS gITS7/ITS4
Gene:   FITS
Length of Target:    150-330
get_seeds_local() minimum length:    105
get_seeds_local() maximum length:    500
blast_seeds() minimum length:    65
blast_seeds() maximum length:    461
max_to_blast:  100
Forward Sequence (5'-3'):   GTGARTCATCGARTCTTTG
Reverse Sequence (5'-3'):    TCCTCCGCTTATTGATATGC
Reference:    White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315–322.
Ihrmark, K., Bödeker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., & Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region–evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.