Golden Gate compatible plasmid for lineage tracing in mammalian systems

EB04119, Golden Gate-compatible lentiviral barcoding vector with mScarlet dropout cassette (10,917 bp). EB04119 is a derivative of pEGZ2 (REF1,2) domesticated for Golden Gate cloning. An internal BsmBI site in the hygromycin cassette was removed by a synonymous substitution (GTC→GTT). A bacterial mScarlet dropout cassette flanked by two outward-facing BsmBI sites was inserted between the WPRE and the bGH polyA signal. The BsmBI sites produce the EMMA position-17 fusion sites GCTC and CGGT (REF 3). The vector was then reassembled from five PCR fragments by Golden Gate with PaqCI to add a sequencing-primer binding site; the final vector contains no PaqCI sites. The final construct was sequence-verified.This record contains the vector with the dropout cassette. Barcodes are inserted by a second Golden Gate reaction with BsmBI and annealed oligonucleotides, which replaces the cassette (transformants with the barcode are white, those with the cassette red). The barcode (42 nt) has seven blocks of three random nucleotides alternating with constant sequences (21 random positions; theoretical diversity 4.4 × 10¹²). The barcoded product is 9,951 bp. EB04120, sequence-verified barcoded lentiviral vector derived from EB04119 (9,951 bp). EB04120 is an example of a final barcoded vector produced from EB04119 (this record) by Golden Gate cloning with BsmBI and annealed barcoded oligonucleotides, which replaces the mScarlet dropout cassette with a 42 nt barcode insert. The insert lies between the WPRE (positions 1181–1769) and the bGH polyA signal (from position 1834), flanked by the EMMA position-17 overhangs GCTC (1784–1787) and CGGT (1830–1833), both given 5′→3′ on the top strand. The barcode (positions 1788–1829, top strand: AGTCAGTGAGTTCGTACTATGCTCTTCAGGTATGACTAAGAG) is one clone from the semi-random barcode design: seven blocks of three random nucleotides alternating with seven constant trinucleotides (21 random positions; theoretical diversity 4.4 × 10¹²). In this file the barcode is on the reverse strand, so its constants (CTC, GTC, CCT, GAG, AGT, AAC, CTG) read as their reverse complements. The sequence contains no BsmBI or PaqCI sites. The whole plasmid was sequence-verified . Used in"Barcoded-Plasmid DNA library construction for recording cell lineage tracing enabled by a Scalable and modular Biofoundry-based Automated Robotic Pipeline" as an example of a library member. EB01447, earlier-generation lentiviral barcoding vector (9,925 bp). This sequence was used for the manual plasmid extractions in "Barcoded-Plasmid DNA library construction for recording cell lineage tracing enabled by a Scalable and modular Biofoundry-based Automated Robotic Pipeline" as a comparison arm for the automated extraction. It is a barcoded derivative of a domesticated, Golden Gate-compatible version of pEGZ2 ((REF1,2) and contains no BsmBI or PaqCI sites. The vector was verified by sequencing. The 42 nt barcode region has the same design as in EB04119: seven random NNN blocks alternating with constant sequences (21 random positions). Here the barcode lies downstream of EGFP and upstream of the WPRE, whereas in the EB04119-derived barcoded vectors (9,951 bp) it lies between the WPRE and the bGH polyA signal. 1.Wojtowicz, E. et al. Panhematopoietic RNA barcoding enables kinetic measurements of nucleate and anucleate lineages and the activation of myeloid clones following acute platelet depletion. Genome Biology 24 (06/27/2023). https://doi.org/10.1186/s13059-023-02976-z 2.Belderbos, M. E. et al. Clonal selection and asymmetric distribution of human leukemia in murine xenografts revealed by cellular barcoding. Blood 129 (06/15/2017). https://doi.org/10.1182/blood-2016-12-758250 3.Martella A, Matjusaitis M, Auxillos J, Pollard SM, Cai Y. EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors. ACS Synth Biol. 2017 Jul 21;6(7):1380-1392. doi: 10.1021/acssynbio.7b00016.