TABLE 1 in A new species of planthopper in the genus Jamaha (Hemiptera: Fulgoroidea Nogodinidae) from the Northeastern coast of Jamaica

TABLE 1. Primers used to amplify corresponding gene regions used to assess the placement of novel taxon and PCR parameters for each locus. LocusPrimerDirectionSequence (5’ -3’)AnnealingExtensionReferenceCOICOI_D1_F C1-J-2195RCForward ReverseGGAACWATAAGAAGWATAATYATYCG ACTTCTGGATGACCAAAAAATCAA40˚C1 min. 30 sec.Humphries et al. 202118S18SF 18SRForward ReverseACTGTCGATGGTAGGTTCTG GTCCGAAGACCTCACTAAA50˚C2 min.Bahder et al. 2019