PCSK9 is involved in human induced pluripotent stem cell proliferation through the regulation of the NODAL signaling pathway
收藏资源简介:
Proprotein convertase subtilisin kexin type 9 (PCSK9) is a key regulator of LDL cholesterol metabolism and the target of lipid-lowering drugs. PCSK9 is mainly expressed in hepatocyte. Here, we show that PCSK9 is highly expressed in undifferentiated hiPSCs. PCSK9 inhibition in hiPSCs with the use of shRNA, CRISPR/cas9-mediated knockout or endogenous PCSK9 loss-of-function mutation R104C/V114A unveiled its new role as a potential cell cycle regulator through the NODAL signaling pathway. Indeed, PCSK9 inhibition leads to a decrease of SMAD2 phosphorylation and hiPSCs proliferation. Conversely, PCSK9 overexpression stimulates hiPSCs proliferation. PCSK9 can interfere with the NODAL pathway by regulating the expression of its endogenous inhibitor DACT2, which is involved in the TGFÃ-R1 lysosomal degradation. Using different PCSK9 constructs we show that PCSK9 interacts with DACT2 through its CHRD domain. Altogether these data highlight a new role of PCSK9 in cellular proliferation and development, beyond its canonical effect on lipid metabolism. Overall design: PCSK9 has been either: knocked out using CRISPR-Cas9 gene edition system (PCSK9-ko; N=12) or overexpressed (PCSK9-overexpression; N=3) in induced pluripotent stem cells. PCSK9 knockout in control hiPS cells was generated using the Alt-R⢠CRISPR-Cas9 System (Integrated DNA Technologies) targeting the exon 7 of PCSK9 at both alleles. Briefly gRNA CCAGCGACTGCAGCACCTGC was first duplexed with the Alt-R® CRISPR-Cas9 tracrRNA, then complexed to the Alt-R® S.p. Cas9 Nuclease according to IDT recommandations. Full length PCSK9 overexpression has been obtained by specific insertion at the AAVS1 site with plasmids encoding for hAAVS1 1R TALEN (Addgene #35432) and hAAVS1 1L TALEN (Addgene #35431) homologous sequences. Thereafter, hiPSCs were selected with Puromycin (TOCRIS Bioscience 4089/50; up to 8µg/ml) and verified by PCR sequencing




