Mettl3 maintains genome stability of erythroid cells via Mthfd1-mediated nucleotide biosynthesis
收藏资源简介:
N6-methyladenosine (m6A) is a prevalent modification of mammalian mRNA. Increasing evidence has documented diverse roles of m6A in normal cell physiology and diseases. However, our knowledge on the role of the m6A in erythropoiesis is very limited. A previous study implicated the role of METTL3, the catalytic enzyme for m6A modification, in human erythropoiesis in vitro. But the function role of METTL3 in vivo has yet to investigated. In this study, we found that deletion of Mettl3 using EpoR-Cre mouse led to microcytic/hypochromic anemia due to defective erythropoiesis along with impaired hemoglobin biosynthesis. Mechanically, Mettl3 deficiency disrupted nucleotide biosynthesis which induced DNA damage, leading to apoptosis of CFU-E cells and cell cycle arrest of erythroblasts. Integrated m6A sequencing and RNA-seq analysis along with biochemical studies identified Mthdf1, a key enzyme involved in nucleotide biosynthesis, as a Mettl3 direct target gene. Furthermore, deletion of Mettl3 led to decreased expression of Mthdf1 accompanied by a shortage of nucleotides dTMP and IMP in erythroid cells. Additionally, inhibition of METTL3 in human erythroid cells led to similar phenotypic and molecular changes, indicating conserved role of METTL3 in human and murine erythropoiesis. Our findings have identified a novel Mettl3-m6A-Mthfd1 axis that plays a critical role in erythropoiesis by maintaining genome stability of erythroid cells via regulation of nucleotide biosynthesis. These findings provide novel insights into the regulatory mechanisms of erythropoiesis. Overall design: Mouse erythroid progenitor cells and proerythroblasts were sorted, collected, and washed twice with PBS, then amplified by the Smart-Seq2 method. An Oligo-dT primer was used in the reverse transcription reaction for first-strand cDNA synthesis, followed by PCR amplification to enrich the cDNA and a magbeads purification step to clean up the product. Next, the cDNA was randomly fragmented by ultrasonic waves prior to Illumina library preparation. After library preparation, PerkinElmer LabChip® GX Touch and Step OnePlus⢠Real-Time PCR System were introduced for library quality inspection. Qualified libraries were then loaded on Illumina Hiseq platform for PE150 sequencing.For m6A-seq, m6A immunoprecipitation was performed according to the standard protocol. The cDNA was fragmented to ~300 bp using Tn5 transposase and processed using the TruePrep DNA Library Prep Kit V2 (Vazyme, TD501). Final libraries were amplified with the Tn5 adaptor and 3' primer (AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTAATACGACTCACTATA) and sequenced as 150-bp paired-end reads on an Illumina HiSeq X Ten platform.



