Structural perturbation of chromatin domains with multiple developmental regulators can severely impact gene regulation and development [RNA-seq-blastocyst]

Chromatin domain boundaries delimited by CTCF motifs can restrict the range of enhancer action. However, disruption of domain structure often results in mild gene dysregulation and thus predicting the impact of boundary rearrangements on animal development remains challenging. Here, we tested whether structural perturbation of a chromatin domain with multiple developmental regulators can result in more acute gene dysregulation and severe developmental phenotypes. We targeted clusters of CTCF motifs in a domain of the mouse genome containing three FGF ligand genes¬—Fgf3, Fgf4, and Fgf15—that regulate several developmental processes¬. Deletion of the 23.9kb cluster that defines the centromeric boundary of this domain¬ resulted in ectopic interactions of the FGF genes with enhancers located across the deleted boundary that are active in the developing brain. This caused strong induction of FGF expression and perinatal lethality with encephalocele and orofacial cleft phenotypes. Heterozygous boundary deletion was sufficient to cause these fully penetrant phenotypes, and strikingly, loss of a single CTCF motif within the cluster also recapitulated ectopic FGF expression and caused encephalocele. However, such phenotypic sensitivity to perturbation of domain structure did not extend to all CTCF clusters of this domain, nor to all developmental processes controlled by these three FGF genes¬—for example, the ability to undergo lineage specification in the blastocyst and pre-implantation development were not affected. By tracing the impact of different chromosomal rearrangements throughout mouse development, our work starts to uncover the determinants of phenotypic robustness and sensitivity to perturbation of chromatin boundaries. Our data show how small sequence variants at certain domain boundaries can have a surprisingly outsized effect and must be considered as potential sources of gene dysregulation during development and disease. RNA sequencing was done in single blastocysts, by isolating RNA using Dynabeads mRNA DIRECT Purification Kit as previously described (Huffman et al., 2012). Blastocysts at E4.5 were flushed out of the uterine horns from super-ovulated females using M2 media and transferred into 50 µl of pre-warmed lysis buffer (100mM Tris-HCl pH-7.5, 500mM LiCl, 10mM EDTA pH-8, 1%LiDS, 5mM DTT) in DNA low binding PCR tubes. Lysed embryos were stored in -20C and processed within a few weeks. Dynabeads Oligo(dT)25 mRNA isolation beads were warmed to room temperature for 30 mins and rinsed with 100 µl of lysis buffer by vortexing continuously for 5 mins. 10 µl of bead suspension was used per embryo lysate. The poly A tail of mRNA was allowed to anneal to beads by mixing the embryo lysates and bead suspension in a vortexer for 5 mins at low speed, followed by 5 mins incubation without shaking. Tubes were briefly spun and placed in a magnetic stand to collect the clear supernatant, which was used for DNA isolation using 2X SPRI beads to determine the genotype of each embryo. mRNA bead complexes were washed twice using Wash Buffer A and twice with Wash Buffer B by vortexing for 5 mins each. cDNA and library prep were then processed using an adaptation of the smartseq2 protocol (Picelli et al., 2014; Satija et al., 2015; Trombetta et al., 2014). Buffers were removed and beads annealed with mRNA was resuspended in 12.5µl of RNA suspension mix containing 20U/µl SUPERase-In RNase inhibitor (Thermo Fisher, #AM2694), 10mM each dNTP Mix (New England Biolabs, #N0447L) and 100µM polydT oligonucleotide primer (custom sequence ‘AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN’ synthesized by Integrated DNA Technologies). Bead suspension is heated at 75°C for 5mins to denature the RNA and supernatant is transferred into a new RNase free 0.2ml PCR tube. To each sample tube 7.5µl of first strand reverse transcription mix with 100mM DTT, 5X SuperScript IV Buffer, SuperScriptTM IV Reverse Transcriptase (Thermo Fisher, #18090050), 20U/µl SUPERase-In RNase inhibitor (Thermo Fisher, #AM2694), 100µM of template switching oligo with 3G’s and an adaptor sequence same as polydT oligonucleotide (custom sequence ‘AGACGTGTGCTCTTCCGATCTNNNNNrGrGrG’, Integrated DNA Technologies) was added and incubated at 50°C for 60 mins to prepare the first strand of cDNA, followed by 85°C for 5mins to inactivate the enzyme. The first strand of cDNA is bound by the template switching oligo and a complementary sequence to the template switching oligo was synthesized, where a PCR oligo is hybridized (custom sequence ‘AGACGTGTGCTCTTCCGATCT’, Integrated DNA Technologies) and amplified. PCR cDNA amplification was done for 16 cycles (98°C for 15 secs, 67°C for 20 secs and 72°C for 10 mins) in a thermal cycler with KAPA Hifi HotStart ReadyMix (Roche, #9420398001). Pre-amplication cDNA mix was purified with 0.8X SPRI beads and quality of cDNA was assessed with a D5000 Screen Tape assay (Agilent, #5067-5588) using Agilent 4150 Tapestation. cDNA mix was diluted to 0.2ng/µl and used for library preparation as described earlier (Trombetta et al., 2014) using Nextera XT DNA Library Prep Kit (Illumina, #FC-131-1024). Briefly, in a 384 well plate, 1 µl of cDNA, 2µl of Tagment DNA Buffer and 1µl of Amplicon Tagment Mix was mixed in ice and tagmentation was done in a thermocycler at 55°C for 10 mins. Reaction was neutralized with 1 µl of Neutralize Tagment Buffer, incubated at room temperature for 5 mins and transferred to ice. Amplification PCR was set up with 3µl of Nextera PCR Mastermix and 2µl of each adaptor from Illumina DNA/RNA UD Indexes Set A (Illumina, #20027213) per sample. Tagmented DNA was incubated at 72°C for 3 mins, 95°C for 30 secs and 12 cycles of 95°C for 10 secs, 55°C for 30 secs, 72°C for 1 min and a final extension at 72°C for 5 mins. Library DNA was purified with 0.9X SPRI and quality was assessed using D1000 Screen Tape assay (Agilent, #5067-5585) before sequencing.