Supplemental file

Table S1.The standard curve of log10CFU-Ct value Strain Standard curve R2 Bifidobacterium Log10CFU=-0.2527Ct+13.982 0.9967 B. infantis Log10CFU=-0.2405Ct+13.237 0.9996 Table S2. The reaction system of Bifidobacterium and B. infantis Reagent name Volume（L） SYBR Premix Ex Taq II 12.5 Forward Primer 10 μM 1 Reverse Primer 10 μM 1 DNA 2 dd H2o 8.5 Total volume 25 Table S3. The primer sequence of Bifidobacterium and B. infantis Target Sequence (5’-3’) Bifidobacterium-F CTCCTGGAAACGGGTGG Bifidobacterium-R GGTGTTCTTCCCGATATCTACA B. infantis-F TTCCAGTTGATCGCATGGTC B. infantis-R GGAAACCCCATCTCTGGGAT F: Forward. R: Reverse. Table S4. The reaction program of Bifidobacterium and B. infantis Stage Temperature（°C） Time（s） Pre-denaturation 95 10 Denaturation 94 20 Annealing 55 20 Extension 72 50 Cycle X 40 Melting curve 65 to 95°C, increment 0.5°C， for 5 S Table S5. The reverse transcription reaction system of spleen cytokines Reagent name Volume（L） 5× iScript Reaction Mix 4 iScript Reverse Transcriptase 1 RNA 1 dd H2o 14 Total volume 20 Table S6. The reverse transcription reaction program of spleen cytokines Stage Temperature（°C） Time（s） Priming 25 5 Reverse Transcription 46 20 RT inactivation 95 1 Hold 4 Table S7. The reaction system of spleen cytokines Reagent name Volume（L） 2× Mix 5 Forward Primer 0.5 Reverse Primer 0.5 cDNA 1 dd H2o 3 Total volume 10 Table S8. The primer sequence of spleen cytokines Target Sequence (5’-3’) -actin-F GTGGGCCGCTCTAGGCACCAA -actin-R CTCTTTGATGTCACGCACGATTTC IL-6-F GTCACAGAAGGAGTGGCTA IL-6-R AGAGAACAACATAAGTCAGATACC IL-10-F GACCAGCTGGACAACATACT IL-10-R GAGGGTCTTCAGCTTCTCAC IL-12P40-F CTCTGTCTGCAGAGAAGGTC IL-12P40-R GCTGGTGCTGTAGTTCTCAT TNF--F CTCTTCAAGGGACAAGGCTG TNF--R CGGACTCCGCAAAGTCTAAG F: Forward. R: Reverse. Table S9. The reaction program of spleen cytokines Stage Temperature（°C） Time（s） Pre-denaturation 98 30 Denaturation 98 15 Annealing/ Extension 60 30 Cycle X 39