TABLE 2 in Genetic analysis of a Mediterranean Red-Listed species Brachytrupes megacephalus (Lefèbvre, 1827) (Orthoptera, Gryllidae)

TABLE 2. List of primers used in this study including the region, name, sequence and reference for each. NumberName of primerRegionSequence of Primer 5-3' directionPaper reference112SF12STACTATGTTACGACTTATKamphambati 1995 as cited in Chintauan-Marquier et al. 2016212SR12SAAACTAGGATTAGATACCCKamphambati 1995 as cited in Chintauan-Marquier et al. 2016318S-A218SATGGTTGCAAAGCTGAAACGiribet et al. 1999 as cited in Chintauan-Marquier et al. 2016418S-9R18SGATCCTTCCGCAGGTTCACCTACGiribet et al. 1999 as cited in Chintauan-Marquier et al. 20165HisFH3ATGGCTCGTACCAAGCAGACGGCSvenson and Whiting 2004 as cited in Chintauan-Marquier et al. 20166HisRH3ATATCCTTGGGCATGATGGTGACSvenson and Whiting 2004 as cited in Chintauan-Marquier et al. 2016728S--R1.2a28SCCC SSG TAATTTAAGCATATTAWhiting 2002 as cited in Chintauan-Marquier et al. 2016828S-Rd3b28SCCYTGAACGGTTTCACGTACTJarvis et al. 2004 as cited in Chintauan-Marquier et al. 2016928SF428SCGACACGCCCCGATCCTCAGAGCCAKamphambati 1995 as cited in Chintauan-Marquier et al. 20161028SR428SGATTCTGACGTGCAAATCGATCKamphambati 1995 as cited in Chintauan-Marquier et al. 20161116S2216SCCGGTCTGAACTCAGATCAYeh and Yang 1997 as cited in Pradit et al. 20221216SR2116SGCCTGTTTATCAAAAACATYeh and Yang 1997 as cited in Pradit et al. 202213LCO1490COIGGTCAACAAATCATAAAGATATTGGFolmer et al. 1994 as cited in Pradit et al. 202214HCO2198COITAAACTTCAGGGTGACCAAAAAATCAFolmer et al. 1994 as cited in Pradit et al. 2022