Nanopore contamination search results

We searched the NCBI core nt database (810GB) for Nanopore sequence contamination. Rapid barcoding (rapid_ncbi_search_filtered.tsv) We searched for 5' - GCTTGGGTGTTTAACC - barcode - GTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTTCGTGCGCCGCTTCA - 3', replacing "barcode" with all 96 barcodes. The entire sequence was allowed to match with at most 20 edits and the barcode had to match with <=4 edits.Native barcoding (native_ncbi_search_filtered_strict.tsv) We searched for 5' - AAGGTTAA - barcode - CAGCACCT - 3' and sequence: 5' - GGTGCTG - barcode - TTAACCTTAGCAAT - 3' with all 96 barcodes. The entire sequence had to match with at most 4 edits, and so did the barcode. This is more stringent than rapid barcoding searches as the flanks are much shorter.