Table A 2 in A consolidated phylogeny of snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Colombia, Ecuador, and Panama

Table A2. List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C. LocusPrimerSequence (5 ’-3’)ReferencePCR profile:12SH1557modGTACRCTTACCWTGTTACGACTTZaher et al. 200993 °C (1 min), 54 °C (1 min), 72 °C (2-5 min) [x25-40]L1091modCAAACTAGGATTAGATACCCTACTAT16S16Sar-LCGCCTGTTTATCAAAAACATPalumbi et al. (1991)94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min) [x30]16Sbr-H-RCCGGTCTGAACTCAGATCACGTCOIRepCOI-FTNTTMTCAACNAACCACAAAGAMurphy et al. (2013)94 °C (3 min), 48.5 °C (30 sec), 72 °C (1 min) [x40]RepCOI-RACTTCTGGRTGKCCAAARAATCACytbL14910GACCTGTGATMTGAAAACCAYCGTTGTBurbrink et al. (2000)94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30-36]H16064CTTTGGTTTACAAGAACAATGCTTTAND4ND4CACCTATGACTACCAAAAGCTCATGTAGAAGCArévalo et al. (1994)94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25-30]LeuCATTACTTTTACTTGGATTTGCACCA