IDENTIFICATION OF MUTATIONS IN POLISH LAN-NEGATIVE INDIVIDUALS AND THEIR RELATIVES

Background: Anti-Lan antibodies may cause hemolytic transfusion reactions. Antigen-negative donors should be selected for immunized patients but such donors are extremely rare and difficult to identify with serological methods. Since 2012 when the genetic background of Lan was first described in Lan-negative Caucasian individuals there appeared reports on multiple mutations in ABCB6 gene. Aim: Analysis of Polish Lan-negative individuals and their relatives for the identification of molecular background of Lan negativity in our population.Methods: DNA was isolated from whole blood of 8 patients with anti-Lan using NucleoSpin Blood Kit (Marcheney Suddenly GmbH) and direct DNA sequencing of ABCB6 (19 exons) was performed on 3130 Genetic Analyzer (Applied Biosystems).Results: In the 7 individuals with anti-Lan the ABCB6*01N.13 (c.574C>T) allele was detected as a homozygous mutation, and as heterozygous in the three children of one patient.In one patient 3 heterozygous alterations: c.827G>A in exon 3; c.1302-1326dupGAGAACCAAGTTTCGTCGTGCTATG in exon 7 (novel); c.1762G>A in exon 12; of ABCB6.Conclusion: The polymorphism c.574C>T in ABCB6 is the most frequent cause of Lan-negativity in the Polish individuals. Genetic screening of ABCB6*01N.13 using real-time PCR will allow to identify rare Lan-negative donors in Polish population. Novel duplication in ABCB6 requires further investigation and a family studies if possible.