ACCase and ALS gene sequences of multi-resistant Lolium spp. from three European countries
收藏资源简介:
Annual ryegrass species (Lolium spp.) infest cereal crops worldwide. Ryegrass populations with multiple resistance to the two herbicide groups most widely used for their control, the acetyl coenzyme A carboxylase (ACCase) and acetolactate synthase (ALS) inhibitors, are an increasing problem in several European countries. We investigated the resistance patterns and levels of resistance in ryegrass populations collected in Denmark, Greece and Italy and studied the diversity of mechanisms endowing resistance, both target-site (TSR) and metabolism based. TSR has been extensively studied in the last fifteen years and many of the known mutations responsible for herbicide resistance in the ALS and ACCase genes have been found in Lolium spp. populations. In this study, twelve populations of Lolium spp. collected in winter cereal fields of three European countries, Italy (pops IT533, IT595, IT609 and IT620), Denmark (pops DK6, DK29, DK47 and DK90) and Greece (pops GR9, GR20, GR24 and GR30), where ALS and ACCase inhibitors failed to control their infestation, were analysed for TSR. A 1600 bp region of the CT domain of the plastidic ACCase gene was amplified by PCR on gDNA using the primers acclr9 (5’- ATGGTAGCCTGGATCTTGGACATG-3’) and acclr6 (5’- GGAAGTGTCATGCAATTCAGCAA-3’). PCR products obtained from each plant were sequenced using primers LOL_FOR (5’- CTGTCTGAAGAAGACTATGGCCG-3’) and LOL_FOR_SEQ (5’- GAGGTGGCTCAGCTATGTTCCTG-3’). Similarly, a 1719 bp fragment of the ALS gene was amplified from each DNA extracted with primers LOL_ALS_F (5’- CCGCAAGGGCGCCGACATCCTCGT -3’) and LOL_ALS_R (5’- CGAAATCCTGCCATCACCTTCCAT-3’). PCR products were sequenced using primers LOL_ALS_FOR and ALS_LOL_FS (5’- TCCATCACCAAGCACAACTACCTC-3’). ALS genotyping revealed that in the different populations nine different ALS variant alleles with different frequencies were found: five different allelic variants in position 197 (Ala197, Gln197, Leu197, Ser197 and Thr197), Val205, two allelic variants in position 376 (Asn376 and Glu376) and Leu574; ACCase genotyping revealed that no ACCase variant alleles were detected in the resistant plants of the four Danish populations, whereas seven different types of ACCase variant alleles were detected in the populations from Greece and Italy: Leu1781, Cys2027, two allelic variants in position 2041 (Asn2041 and Val2041), Gly2078, Arg2088 and Ala2096. This repository stores the Sanger Sequencing data of a sequence for each allelic variant found in Lolium spp. plants for both ALS and ACCase genes.



