Mechanisms of heat-induced transcriptional memory profiled in mouse embryonic fibroblasts (MEFs).. Mechanisms of heat-induced transcriptional memory profiled in mouse embryonic fibroblasts (MEFs).
收藏资源简介:
Precision run-on sequencing (PRO-seq) of nascent RNA synthesis across the mouse genome. The PRO-seq data was generated from MEFs that were either unconditioned (unC) or preconditioned with a single 1h heat shock exposure, followed by a 48-h recovery (preC).The unconditioned and preconditioned cells were subjected to a single heat shock, during which the the kinetics of nascent transcription response was monitored. Overall design: Genome-wide nascent transcription profiles mapped in MEFs in non-strss conditions, upon 1h heat shock and 4h recovery from heat shock. Additionally, MEFs were either unconditioned or preconditioned with a single heat shock exposure, and the kinetics of transriptional response to heat shock monitored with PRO-seq upon 0', 12.5', 25' and 40' additional heat shock exposure. Please note that [1] the Normalized_*.bigWig processed data was generated from all replicates combined and is linked to the corresponding replicate 1 sample records (i.e.*BR1, *BR1a samples) [2] the Normalized_PROseq_MEF_uC_12HS_BRs_*Strand.bigWig processed data was generated from GSM1843440 (GSE71708) raw data (5' adapter sequence: TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC) and is linked as Series supplementary files.




