rCRUX Generated MiFish Universal 12S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  MiFish Universal
Gene:   12S
Length of Target:    163–185
get_seeds_local() minimum length:    170
get_seeds_local() maximum length:    250
blast_seeds() minimum length:    140
blast_seeds() maximum length:    250
max_to_blast:  1000
Forward Sequence (5'-3'):   GTGTCGGTAAAACTCGTGCCAGC
Reverse Sequence (5'-3'):    CATAGTGGGGTATCTAATCCCAGTTTG
Reference:    Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.