HCV poly-U/UC RNA constructs developed for RIG-I binding and activation studies.

aThe X-region RNA construct has the sequence 5′-GGUGGCUCCAUCUUAGCCCUAGUCACGGCUAGCUGUGAAAGGUCCGUGAGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCUCUGCAGAUCAAGU-3′. The X-region-U34 RNA construct has the sequence 5′-GGGUGGCUCCAUCUUAGCCCUAGUCACGGCUAGCUGUGAAAGGUCCGUGAGC(U34)CGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCUCUGCAGAUCAAGU-3′.bAll RNAs include a 5′-ppp and three guanine nucleotides at the 5′ end of the RNA. Dashes indicate nucleotide deletions, and underlined nucleotides show changes from the HCV Con1 poly-U/UC sequence. Long homo-polymeric nucleotide sequences are indicated in parentheses with the nucleotide designation followed by the number of nucleotides in the sequence.