CCA-depleted tRNA-sequencing data of D. discoideum in different developmental stages

CCA-depleted tRNA-sequencing data of Dictyostelium discoideum in different developmental stages (0h, 6h, and 16h after starvation) which were incubated with recombinant CCA1 or CCA2 for CCA addition. High-throughput analysis of the libraries was done as single end run (150 nt) on a MiSeq System (Illumina) with a custom primer designed for Illumina MiSeq analysis (CACTGTCGGTACCGAGCTTGCATGGAGTCCTA). In D. discoideum, however, both enzymes exhibit identical activities, representing bona-fide CCA-adding enzymes. We have identified the first organism with two tRNA nucleotidyltransferases that both synthesize complete CCA termini without an evident tRNA substrate specificity. Our data indicate that the redundant activities of both CCA1 and CCA2 in D. discoideum seem to be essential throughout the individual developmental stages. Whether these enzymes, in particular CCA2, exhibit an additional function besides tRNA maturation, is a fascinating aspect and deserves further investigations.