Supplementary_Data.xlsx

Around 20 NSN- or SN-GVOs per replica were collected and processed to obtain hairpin-bisulfite amplicons for major satellites and IAP_LTR1a. Briefly, 100 ng salmon sperm DNA was added as carrier DNA and samples were treated with Proteinase K (0.2 mg/ml in 2 mM Tris-HCl, 1 mM EDTA). Proteinase K was inactivated with 8.14 mM Pefabloc SC (Sigma-Aldrich), followed by restriction with DdeI (NEB) for IAP-LTR1a or Eco47I (Fermentas) for major satellites. Subsequently, ligation of the Hairpin linker (Pho-TNACCCGGTADDDDDDDDTACCGGG for IAP_LTR1a and Pho-GACGGGCCTADDDDDDDDTAGGCCC for major Satellites) was performed with T4 Ligase (NEB) and samples were bisulfite treated. Amplification was performed using HOT FIREPol DNA Polymerase (Solis BioDyne) using fusion primer including sequences for preparation of TruSeq amplicon libraries (major Satellites: 95°C 15’ 40x (95°C 1’, 56°C 2’, 72°C 1’) with F-ccatctcatccctgcgtgtctccgacgactacgagtgcgtggaaaatttagaaatgtttaatgtag, R-cctatcccctgtgtgccttggcagtcgactacgagtgcgtaacaaaaaaactaaaaatcataaaaa; IAP-LTR1a: 95°C 15’ 45x (95°C 1’, 51°C 45’’, 72°C 1’) supplemented with HotStart IT Binding Protein (Affymetrix) with F-ccatctcatccctgcgtgtctccgacgactacgagtgcgtttttttttttaggagagttatattt, R-cctatcccctgtgtgccttggcagtcgactacgagtgcgtatcactccctaattaactacaac). Amplicons were purified and further amplified with TruSeq primers including barcodes (5 cycles), pooled and sequenced on an Illumina Miseq machine in a 2x150 bp run. Obtained reads were analyzed using BiQAnalyzer HT. The methylation pattern obtained and the sequence identity, conversion rate of the DNA and the linker are given.