Neurons in the caudal ventral lateral medulla mediate descending pain control
收藏资源简介:
Supraspinal brain regions modify nociceptive signals in response to various stressors including stimuli which elevate pain thresholds. The medulla oblongata has previously been implicated in this type of pain control, but the neurons and molecular circuits involved have remained elusive. Here we identify catecholaminergic neurons in the caudal ventrolateral medulla that are activated by noxious stimuli in mice. Upon activation, these neurons produce bilateral feed-forward inhibition that attenuates nociceptive responses through a pathway involving the locus coeruleus and noradrenalin in the spinal cord. This pathway is sufficient to attenuate injury-induced heat allodynia and is required for counter-stimulus induced analgesia to noxious heat. Our findings define a component of the pain modulatory system that regulates nociceptive responses. Methods Animals All experiments using mice followed National Institutes of Health (NIH) guidelines and were approved by the National Institute of Dental and Craniofacial Research (NIDCR) ACUC. Mice were housed in small social groups (4–5 animals) in individually ventilated cages under 12-h light/dark cycles and fed ad libitum. Animals of both sexes aged 7–12 weeks were used in experiments. C57BL/6N wild-type mice were purchased from Envigo. TH-IRES-CreER mice (The Jackson Laboratory, 00852), TH-IRES-Cre mice (European Mouse Mutant Archive; stock no. EM:00254; backcrossed five generations with C57BL/6NJ mice) and Ai9 reporter mice (The Jackson Laboratory, 007909) were bred in-house. Animals were randomly allocated to the different experimental conditions reported in this study. Genotyping of offspring from all breeding steps was performed with genomic DNA isolated from tail snips. Viral vectors AAV2/5-Ef1a-DIO hChR2(E123T/T159C)-EYFP, AAV1-hSyn-Cre, AAV9-CAG-FLEX-GCaMP6s-WPRE-SV40 and AAV9-hSyn-eGFP were obtained from the Vector Core of the University of Pennsylvania. AAV9-CAG-FLEX-tdTomato, AAV2-mCherry-FLEX-dtA, AAV9-hSyn-DIO-mCherry-2A-Syb-GFP, AAV2-hSyn-DIO-hM4Di-mCherry, AAV2-Syn-DIO-mCherry, and AAV2-Syn-DIO-GFP were produced by the Vector Core of the University of North Carolina. AAVDJ-CAG-FLEX-TVA-mCherry was obtained from viral vector core at Salk Institute. AAVretro-CAG-GFP (Addgene no. 37825-AAVrg), AAV1-CAG-FLEX-jGCaMP7s-WPRE (Addgene, 104495-AAV1), AAV5-hSyn-FLEX-ChrimsonR-tdTomato (Addgene, 62723) and AAV2-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361-AAV2) were produced by Addgene. AAV2(retro)-CAG-iCre (Addgene, 81070) was produced by Vector Biolabs. AAV2/9-hSyn-FLEX-TVA-P2A-EGFP-2A-oG and EnvA-SAD-∆G-mCherry were gifts from Y. Liu at NIDCR/NIH. AAV8-CAG-FLEX-TCB (TVA-mCherry), AAV-EF1a-DIO-HB and EnvA-SAD-∆G-GFP were obtained from GT3 Core Facility of the Salk Institute. All viral vectors were stored in aliquots at −80 °C until use. Anterograde tracing AAV1-hSyn-Cre and AAVretro-CAG-GFP were bilaterally injected into lumbar SC of Ai9 mice. Postsynaptic neurons of SC-projecting neurons in the brainstem were labeled with tdTomato by AAV1-mediated anterograde transsynaptic tagging. Neurons labeled with both tdTomato and GFP are neurons projecting to lumbar SC. Retrograde tracing Three wild-type mice received stereotaxic injections of FG (2.0%, Fluoro-Gold; Fluorochrome) in the LC and CTB (0.5% Cholera Toxin B subunit, LIST Biological Laboratories) in the PVT. Brain tissues were collected 7 d after surgery and processed for histology. Antibodies against CTB (1:500 dilution; 703/AB_2314252, LIST Biological Laboratories) and FG (1:50 dilution; Fluorochrome) were applied along with anti-TH to identify cVLM noradrenergic neurons that project to PVT (TH- and CTB-positive neurons) or LC (TH- and FG-positive neurons), and cVLM noradrenergic neurons, which send collaterals to both. Viral-mediated knockout of tyrosine hydroxylase A guide (GCCAAGGTTCATTGGACGGCGG) specific to TH was used to generate virus (AAV-CMV-FLEX-SaCas9-U6-sgRNA-TH) following the procedures described previously38. Virus was stereotaxically injected to the LC of TH-IRES-Cre mice and behaviors were measured after 3 weeks. Pseudotyped rabies virus tracing Helper AAVs (AAV2/9-hSyn-FLEX-TVA-P2A-EGFP-2A-oG, 200 nl per side) were bilaterally injected into the LC of TH-IRES-Cre mice. The fluorescent reporter (EGFP), the avian receptor (TVA) and the rabies envelope glycoprotein (G) were specifically expressed in noradrenergic neurons in the LC with a Cre-dependent manner. Pseudotyped rabies virus (EnvA-SAD-∆G-mCherry, 200 nl per side) were bilaterally injected into the same location in the LC 2 months later. The G-deficit pseudotyped rabies virus can only infect the noradrenergic neurons that expressed TVA receptor and glycoprotein G. The infectious viral particles generated in these noradrenergic neurons can trans-synaptically spread to presynaptic neurons that made a monosynaptic projection to LC noradrenergic neurons. For rabies virus tracing in the cVLM, helper AAVs (AA8-CAG-FLEX-TCB and AAV-EF1a-DIO-HB) were unilaterally injected into the cVLM, and pseudotyped rabies virus (EnvA-SAD-∆G-GFP, 200 nl) was injected 4 weeks later. Drugs CNO (Abcam, ab141704) was used at a dose of 0.75 mg per kilogram body weight in combination with the excitatory DREADDq and at a dose of 10 mg per kg body weight with inhibitory DREADDi virus. Estrogen receptor modulator, (Z)-4-Hydroxytamoxifen (Abcam, ab141943) was dissolved in corn oil at 20 mg ml−1 and a single intraperitoneal injection of 100 µl corn oil induced Cre-mediated recombination in TH-IRES-CreER mice. Capsaicin (Sigma, M2028) was dissolved in alcohol at 100 mg ml−1 and was diluted to a 1 mg ml−1 working solution with PBS containing 5% Tween-20. Yohimbine hydrochloride was dissolved in dimethylsulfoxide and diluted to a 1 mg ml−1 working solution with PBS. AS19 (Tocris, 1968) was dissolved in dimethylsulfoxide and diluted with PBS. Ondansetron hydrochloride (Tocris, 2891, 10 µg), clonidine hydrochloride (Tocris, 0690; 1 nmol) and AS19 (Tocris, 1968; 10 µg) were prepared with sterile PBS. CFA (Sigma, F5881; 10 µl−1) was subcutaneously injected to induce inflammatory pain. 2-DG (Tocris, 4515, 500 mg per kg body weight) was injected intraperitoneally into the mouse 30 min after CNO administration and 30 min before Hargreaves tests. Antibodies Primary antibodies used were anti-c-Fos (1:500 dilution; goat polyclonal, Santa Cruz, sc-52-G; 1:50 dilution; rabbit monoclonal, Cell Signaling, 2250), anti-TH (1:1,000 dilution; rabbit polyclonal, EMD Millipore, AB152; 1:1,000 dilution mouse monoclonal, MAB5280 or 1:1,000 dilution, chicken polyclonal, Aves Labs, TYH), anti-mCherry (1:1,000 dilution, Thermo Fisher Scientific, rabbit polyclonal, PA5-34974), anti-GFP (1:500 dilution, chicken polyclonal, Aves Labs, GFP-1020 or 1:1,000 dilution, rabbit polyclonal, EMD Millipore, AB3080). Fluorophore-conjugated secondary antibodies were purchased from Thermo Fisher Scientific. Antibodies were diluted in PBS with 10% normal goat serum (NGS) and 0.3% Triton X-100 in PBS (PBST). Stereotaxic surgery All stereotaxic surgeries were conducted as described in our animal study protocol. Mice were anesthetized with a ketamine/xylazine solution (100 mg/10 mg in PBS) and a stereotaxic device (Stoelting) was used for viral injections at the following stereotaxic coordinates: cVLM, −2.50 mm from lambda, ±1.40 mm lateral from midline, and −5.30 mm vertical from cortical surface. LC, −5.50 mm from bregma, 0.95 mm lateral from midline, and −3.50 mm vertical from cortical surface. PVT, −1.6 mm from bregma, −0.06 mm lateral from midline with a six-degree angle, and −3.0 mm from cortical surface. AAVs were injected with an oil hydraulic micromanipulator (Narishige). AAVs were injected at a total volume of 0.1 μl in the cVLM. All other AAVs were injected at approximately 0.2–0.3 μl. Following stereotaxic injections, AAVs were allowed 2–3 weeks for maximal expression. Optical fibers with diameters of 200 μm (0.48 NA) and 400 μm (0.66 NA) were used for optogenetics and fiber photometry experiments, respectively (Doric Lenses). These fibers were implanted over the cVLM or LC immediately after viral injection and cemented using C&B Metabond Quick Adhesive Cement System (Parkell). Mice received subcutaneous injections with ketoprofen (5 mg per kg body weight) for analgesia and anti-inflammatory purposes pre-operatively and post-operatively and were allowed to recover on a heating pad. Histology Mice were euthanized with CO2 and subsequently subjected to transcardiac perfusion with PBS and then with paraformaldehyde (4% in PBS). Brains were then postfixed in 4% paraformaldehyde at 4 °C overnight, and cryoprotected using a 30% PBS-buffered sucrose solution for ~24–36 h. Coronal brain sections (40 μm) were acquired using a cryostat (CM1860, Leica). For immunostainings, brain sections were blocked in 10% NGS in PBST for 1 h at room temperature (RT), followed by incubation with primary antibodies in 10% NGS-PBST for 24–48 h at 4 °C. Sections were then washed with PBST (3 × 15 min) and incubated with fluorescent secondary antibodies at RT for 1 h in 10% PBST. Sections were washed in PBS (3 × 15 min), mounted onto glass slides and cover-slipped with Fluoromount-G (Southern Biotech, 0100-01). Images were taken using a Nikon C2+ confocal microscope. Image analysis and cell counting were performed using ImageJ software by a blinded experimenter (Fiji, version 2017 May 30). Fos expression For c-Fos expression upon capsaicin or ATP administration to plantar skin, mice were anaesthetized with isoflurane (2%) for 5 min. PBS containing 10 nmol of capsaicin or 500 nmol of ATP were injected into the left hind paw of wild-type mice and then mice were returned to the home cage. Brain tissues were collected 1 h after injection and subjected to c-Fos immunohistochemistry analysis. For c-Fos expression in mice with AAV2-DIO-DREADDq-mCherry virus injection, brain tissues were collected 1 h after intraperitoneal injection of CNO. In situ hybridization Multi-label ISH was performed using the RNAscope technology (ACD) according to the manufacturer’s instructions. Probes against TH, DDC, DBH, PNMT, Slc18a2 (Vmat), Slc32a1 (Vgat) and Slc17a6 (Vglut2) in conjunction with the RNAscope multiplex fluorescence development kit. Images were collected on a Nikon C2+ confocal laser-scanning microscope. Bulk Ca2+ and fiber photometry Fiber photometry procedures and calcium measurements were performed by following methods previously described. Mice were first allowed to adapt to the experimental chambers and the attached fiber patch cord for 60 min before each testing session. A fiber photometry system (Doric Lenses) was used to record fluorescence signals. The system is integrated with two continuous sinusoidally modulated LEDs (DC4100, ThorLabs) at 473 nm (211 Hz) and 405 nm (531 Hz), which served as light source to excite GCaMP6s and an isosbestic autofluorescence signal, respectively. Fluorescence signals were collected by the same fiber implant that was coupled to a 400-µm optical patch cord (0.48 NA) and focused onto two separate photoreceivers (2151, Newport Corporation). The RZ5P acquisition system (Tucker-Davis Technologies), equipped with a real-time signal processor controlled the LEDs and also independently demodulated the fluorescence brightness from 473 nm and 405 nm excitation. The LED intensity (range 10–15 μW) at the interface between the fiber tip and the animal was constant throughout the session. All photometry experiments were performed in behavioral chambers, square enclosures on the hot plate (IITC Life Science) or mouse enclosures for Plantar Test Instrument (Ugo Basile). For ΔF/F analysis, a least-squares linear fit to the 405-nm signal to align it to the 470-nm signal was first applied. The resulting fitted 405-nm signal was then used to normalize the 473-nm signal as follows: ΔF/F = (473-nm signal − fitted 405-nm signal) / fitted 405-nm signal. For counter-stimulus experiments, mice were tested three times with 25–55 °C ramps, mice were given a 1-h rest and then injected with capsaicin (counter-stimulus). Next, a further three heat ramp trials were performed. Combined optogenetic stimulation of LC terminals and photometry of LCTH neurons We used one optical fiber as described for photometry experiments. This fiber was connected to a six-port fluorescence mini cube (DoricLens), which allowed combined isosbestic excitation (400–410 nm), GCaMP excitation (460–490 nm) and emission (500–550 nm), and red fluorophore excitation (540–570 nm). Three light sources were used, a 405-nm LED for isosbestic excitation, a 473-nm LED for GCaMP6s excitation and a 561-nm laser for Chrimson excitation. Two separate photoreceivers collected isosbestic and GCaMP6s signals (2151, Newport Corporation). The intensity of illumination from the 473-nm LED was constant throughout the session and was adjusted to a minimal level to detect GCaMP6s signal (10–15 μW at the interface between the fiber tip). Activation of Chrimson was previously reported to occur from the excitation of GCaMP, and this effect would increase the baseline and reduce the signal-to-noise ratio of GCaMP6s signals. Therefore, illumination for GCaMP6s was reduced to a minimum to decrease this effect. Optogenetics TH-IRES-Cre mice injected with either Cre-dependent ChR2 or Cre-dependent GFP (control) in the cVLM and an optical fiber placed above cVLM were behaviorally tested 3 weeks later. Mice were tethered with an optical patch cord and placed in the Perspex enclosure (10 cm × 10 cm × 15 cm) with free movements. After habituation for 60 min, Hargreaves tests were performed to measure the baseline of hind paw withdrawal latency. Then, mice received light stimulation with a blue LED (470 nm; Thorlabs, M470F1) at a frequency of 20 Hz (10 ms width) for 2 min. Hargreaves tests were carried out to measure the hind paw withdrawal latency during the stimulation and at 2 min, 5 min, 10 min, 20 min and 30 min after cessation of stimulation. For optical activation with Chrimson, a 561-nm laser (Opto Engine, 561-50 mW) was used to generate light stimulation at a frequency of 20 Hz (10 ms width) for 2 min during which Hargreaves tests were performed. Mouse behavioral measurements All behavioral experiments were conducted during the light cycle at ambient temperature (~23 ˚C). For all behavioral paradigms, the experimenter was blinded to the genotype of mice under study. Ear-tag numbers were read after experiments and results were unblinded after testing sessions. Hargreaves test Mice were habituated to the testing enclosures (Ugo Basile) for 60 min. Habituation was repeated for 2 d. On testing day, after the mice were acclimatized for 60 min in the testing enclosure, a radiant heat beam was applied to the center of the hind paw and reaction time between the start of the heat stimuli and lifting the hind paw was recorded as the hind paw withdrawal latency. A cutoff time of 15 s was used to prevent tissue damage. Consecutive tests of the same paw were separated by at least 3 min. The test was repeated for five trials for both left and right hind paws. The averages of the withdrawal latencies were calculated. Mild burn was achieved by placing the hind paw, while mice were deeply anesthetized, in a water bath at 55 °C for 15 s. Cold plantar test Cold responses were tested as described previously. Briefly, a dry ice pellet was applied below the hind paw of a mouse sitting on a glass surface and time to withdrawal was measured. Withdrawal was tested five times for each hind paw, and consecutive tests of the same paw were separated by at least 3 min. Itch test Behavioral assessment of scratching behavior was conducted as described previously. Briefly, mice were injected subcutaneously into the nape of the neck with chloroquine. Compounds were diluted in PBS. Scratching behavior was recorded for 30 min and is presented in numbers of bouts observed in 30 min. One bout was defined as scratching behavior toward the injection site between lifting the hind leg from the ground and either putting it back on the ground or guarding the paw with the mouth. Injection volume was always 10 μl. Von Frey test Mechanical sensitivity thresholds were assessed using calibrated von Frey filaments using the simplified up–down method. Animals were acclimatized in a plastic cage with a wire mesh floor for 1 h and then tested with von Frey filaments with logarithmically incremental stiffness (starting with 0.4 g). Each filament was applied for 5 s, and the presence or absence of a withdrawal response was noted. The filament with the next incremental stiffness was then applied, depending on the response to the previous filament, and this was continued until there were six positive responses. The filaments were applied to the glabrous skin on the hind paw, and a positive response was recorded when there was lifting or flinching of the paw. The force required for 50% withdrawal was determined by the up–down method. Rotarod test Motor coordination was tested by measuring the performance on an accelerating rotarod (IITC Life Science) with the rod programmed to accelerate from 4 to 40 r.p.m. over 5 min. During the experimental testing session, the mice were allowed two trial runs followed by four test runs and the average of the maximum r.p.m. tolerated was recorded. For each mouse, the maximum times on the rota-rod were averaged. Hot plate test Hot plate tests (IITC Life Science) were used to assess the nociception upon a high-temperature stimulus. The latency to lick a hind paw when the mouse was placed on a 52.0 °C hot plate was measured. The plate was enclosed with four Plexiglas walls and a lid so that the mouse could not escape. The mouse was removed from the plate after 30 s. Randall–Selitto test A modified Randall–Selitto device (IITC Life Science) was used to automatically measure the responses when pressure was applied to the tail. The mouse was placed into a mouse restrainer with the tail exposed to access with a handheld probe. Pressure was applied to the tail until a response was observed. The maximum force applied during the test was recorded. Feeding behavior As described in a previous paper, TH-IRES-Cre mice injected with either Cre-dependent ChR2 or Cre-dependent mCherry (control) in the cVLM and an optical fiber placed above the pPVT or LC were behaviorally tested 3 weeks later. First, mice were tethered with an optical patch cord and placed in an open-field box (45 × 45 × 40 cm) where they were given access to 20 mg food pellets for 30 min (pre-test). Immediately after the pre-test, mice received light stimulation with a blue laser tuned at 473 nm at a frequency of 20 Hz (duration, 10 ms) for 30 min using a 1 min ‘ON’/2 min ‘OFF’ protocol (stimulation). After light stimulation, mice were given another 30 min with access to food (post-test). In addition, for these mice, the duration, quantity and timing of feeding epochs were quantified using a custom-designed feeding experimentation device (FED3). The power of the blue laser for all experiments was 5–10 mW, measured at tip of the patch cord. Bulk Ca2+ recordings in brain slices TH-IRES-Cre mice were bilaterally injected with AAV5-Syn-FLEX-ChrimsonR-tdTomato virus in cVLM (100 nl per side) and AAV1-CAG-FLEX-jGCaMP7s-WPRE in LC (200 nl per side). Three to four weeks later, mice were anesthetized with isoflurane and transcardially perfused with ice-cold NMDG artificial cerebrospinal fluid (ACSF) (92 mM NMDG, 2.5 mM KCl, 1.25 mM NaH2PO4, 30 mM NaHCO3, 20 mM HEPES, 20 mM glucose, 2 mM thiourea, 5 mM sodium ascorbate, 3 mM sodium pyruvate, 0.5 mM CaCl2·4H2O and 10 mM MgSO4·7H2O; titrate pH to 7.3–7.4 with concentrated hydrochloric acid). Coronal sections containing LC (300 µm thick) were sectioned with a VT1200S automated vibrating-blade microtome (Leica Biosystems) and were subsequently transferred to an incubation chamber containing NMDG ACSF (34–35 °C). After 12 min of recovery, slices were transferred to a modified ACSF (92 mM NaCl, 2.5 mM KCl, 30 mM NaHCO3, 1.25 mM NaH2PO4, 25 mM glucose, 20 mM HEPES, 2 mM thiourea, 5 mM sodium ascorbate, 3 mM sodium pyruvate, 2 mM MgSO4 and 2 mM CaCl2, pH 7.4, gassed with 95% O2 and 5% CO2) at RT (20–24 °C) and remained until imaged. For imaging, slices were placed in the recording chamber containing ACSF (118 mM NaCl, 2.5 mM KCl, 26.2 mM NaHCO3, 1 mM NaH2PO4, 20 mM glucose, 2 mM MgCl2 and 2 mM CaCl2, at 20–24 °C, pH 7.4, gassed with 95% O2 and 5% CO2) and remained there until imaging finished. Images were obtained using a fluorescence microscope (Olympus BX51 microscope) with an Orca Flash 4.0 LT camera and HCImage Live (Hamamatsu) software at two images per second. Light stimulation was achieved using a red laser (635 nm) delivered in 20 Hz for 20 s to activate Chrimson. An LED (Lumen 300-LED, Prior Scientific) was used to activate jGCaMP7s. Images obtained before light stimulation served as baseline, and the fluorescence changes of jGCaMP7s after light stimulation were analyzed with ImageJ. TTX (1 µM) and 4-AP (100 µM) were applied to isolate the monosynaptic response. To isolate the noradrenergic or glutamatergic effects on GCaMP responses, initial recordings were made in ACSF to establish a baseline response, then selective antagonists were applied via the bath. For slices from three different mice, we applied via the bath the beta-adrenergic receptor antagonist propranolol (10 µM) and recorded GCaMP responses at least 10 min after initial application of the antagonist. For slices from a separate set of three mice, we simultaneously applied via the bath the AMPA receptor agonist NBQX (10 µM) and the NMDA receptor antagonist AP5 (50 µM) and recorded GCaMP responses after at least 10 min had passed since initial application of the antagonists. All antagonists were purchased from Tocris (Bio-Techne). Statistics and reproducibility Prism 8.0 (GraphPad) was used for statistical analyses. Differences between mean values were analyzed using an unpaired two-tailed Student’s t-test. Differences were considered significant for *P < 0.05, **P < 0.001, ***P < 0.001 and exact P values are given in the respective figure legend. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in previous publications. Data distribution was assumed to be normal but this was not formally tested. Data collection and analyses were not performed blind to the conditions of the experiment and randomization was not used. No data were excluded from data analysis except where post hoc analysis revealed viral transgene expression was absent in the intended site of injection and where animals were removed from study for humane health reasons. Both criteria were preestablished.



