Cut&tag of H3K4me3 for KDM5A-knockout 293T cell and control 293T.

KDM5A-KO HEK293T cells were purchased from Beyotime (Shanghai, China). These KDM5A-KO HEK293T cells are polyclonal cells infected with lentivirus expressing the single guide RNA (sgRNA) and Cas9 and containing a puromycin resistance cassette and were characterized via a T7EI assay. The sgRNA sequence used to generate the KDM5A-KO cells was TCTCCGCCAAAGGCCGGATG. The sequences of the PCR primers specific for KDM5A were as follows: forwards, 5'CTTCAGCCAGCTTTTCTCCA3'; and reverse, 5'TCAGTTCCCAAGTTCTAGGC3'. H3k4me3(CST) cut&tag was performed for further analysis. Overall design: We compared the h3K4me3 of control and KDM5A-KO cells. Two biological replicates are set for each group, C1 and C2 were control groups from control. And K1, K2 were from KDM5A-knockout groups.