Targeting Menin in T-Lineage Acute Lymphoblastic Leukemia [MEF2CKD]

The efficacy of menin inhibition was evaluated in 14 primary T-ALL samples with diverse genetic backgrounds using ziftomenib. Sensitivity was not correlated with HOXA expression or KMT2A rearrangements, and in vivo treatment significantly reduced tumor burden in xenograft models without notable toxicity. Transcriptomic and proteomic analyses confirmed on-target activity, including downregulation of menin targets and activation of differentiation pathways. Phosphoproteomic profiling identified phospho-MEF2C (S222) as a key marker of sensitivity, regulated by CDK and MAPK signaling. Combination treatment with ziftomenib and CDK1/2 or ERK1/2 inhibitors showed synergistic effects, suggesting a mechanistic link between menin inhibition and p-MEF2C–driven T-ALL vulnerability. Overall design: Karpas-45 cells were thawed and cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin-streptomycin-glutamine at 37°C and 5% CO2. Cells were transduced with lentiviral vectors expressing a GFP-linked shRNA targeting MEF2C (target sequence: CCCAATGAATTTAGGAATGAA). Lentivirus was generated in HEK293T cells via co-transfection of the shRNA plasmid with packaging plasmids psPAX2 and pMD2.G using PEI. Viral supernatants were collected at 48 and 72 hours post-transfection and concentrated by ultracentrifugation. Transductions were performed by spinoculation. After 24 hours, cells were washed and cultured in fresh medium. GFP-positive cells were sorted by FACS at 120 hours post-transduction.