Aphids are major pests of cereal crops and a suite of hymenopteran primary parasitoids play an important role in regulating their populations. However, hyperparasitoids may disrupt the biocontrol serv
Table 1. PCR primer sets used in this study. PrimerOrientationRegionSequence (5'-3')ReferenceMChaF1ForwardCOI ACCTCGAATAAATAATATAAGATTFusu and Polaszek 2017HCO2198ReverseTAAACTTCAGGGTGACCAAAAAATCAFolm
For each species the number of COI, 16S and 18S sequences generated from adult parasitoids and retrieved from GenBank is provided. Non-cereal aphid parasitoids are marked with *; parasitoid species wh