miRNA-seq expression profiling of Huntington's Disease and neurologically normal human post-mortem prefrontal cortex (BA9) brain samples. Homo sapiens
收藏资源简介:
BACKGROUND MicroRNAs (miRNAs) are small non-coding RNAs that recognize sites of complementarity of target messenger RNAs, resulting in transcriptional regulation and translational repression of target genes. In Huntington’s disease (HD), a neurodegenerative disease caused by a trinucleotide repeat expansion, miRNA dyregulation has been reported, which may impact gene expression and modify the progression and severity of HD. METHODS: We performed next-generation miRNA sequence analysis in prefrontal cortex (Brodmann Area 9) from 26 HD, 2 asymptomatic HD, and 36 control brains. Neuropathological information was available for all HD brains, including age at disease onset, CAG-repeat size, Vonsattel grade, and Hadzi-Vonsattel striatal and cortical scores, a continuous measure of the extent of neurodegeneration. Linear models were performed to examine the relationship of miRNA expression to these clinical features, and messenger RNA targets of associated miRNAs were tested for gene ontology term enrichment. RESULTS: We identified 75 miRNAs differentially expressed in HD brain (FDR q-value <0.05). Among the HD brains, nine miRNAs were significantly associated with Vonsattel grade of neuropathological involvement and three of these, miR-10b-5p, miR-10b-3p, and miR-302a-3p, significantly related to the Hadzi-Vonsattel striatal score (a continuous measure of striatal involvement) after adjustment for CAG length. Five miRNAs (miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-10b-3p, and miR-106a-5p) were identified as having a significant relationship to CAG length-adjusted age of onset including miR-10b-5p, the mostly strongly over-expressed miRNA in HD cases. Although prefrontal cortex was the source of tissue profiled in these studies, the relationship of miR-10b-5p expression to striatal involvement in the disease was independent of cortical involvement. Correlation of miRNAs to the clinical features clustered by direction of effect and the gene targets of the observed miRNAs showed association to processes relating to nervous system development and transcriptional regulation. CONCLUSIONS: These results demonstrate that miRNA expression in cortical BA9 provides insight into striatal involvement and support a role for these miRNAs, particularly miR-10b-5p, in HD pathogenicity. The miRNAs identified in our studies of postmortem brain tissue may be detectable in peripheral fluids and thus warrant consideration as accessible biomarkers for disease stage, rate of progression, and other important clinical characteristics of HD. Overall design: 26 Huntington's disease, 2 asymptomatic HD gene positive and 49 neurologically normal control prefrontal cortex samples. Adapter sequence: TGGAATTCTCGGGTGCCAAGG



